AT2G10975

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
4334959 .. 4335909
951 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G10975.1

Sequence Viewer

Length: 402 bp
ATGGCTCTTGGTGGTATTAGGGTATTCATGAAGCCATTCCAGATGCAAAGGATTCAACTCCTTCTCGTCGGAGAAAAGTTTCAAATAGGAGGAAATACTTATTCTGGAAGCAGTGGATCTAAAAGAGCCCACGAGAGTGATGCTAGTGACTCAAACTCTGTAGGATCTAGTGCTCGTCCAATGGAAAGAGATGCTGCTAAGAAAAAGCTAAAAAAAAAGGCACAAGAGTTGGATAGGTTGGAGAAAATAACTATGATGCACAGTGAAACAAACCAATTGATTAAGGAAAAGACTCATGCTAAAAAGATGAAGATGTTTATAGAGCTAACTGAAAAAGAGAATCTCGATGACAAGAGCAAAAAGCTATTGCAACAATTGAGCCACGATCTATTTGGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

15.05

Weight (kDa)

9.73

Isoelectric Point (pI)

31.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020215)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G36675 AT2G10975 AT3G29637 AT3G29637 AT3G29645 AT5G33390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 124, 172
AgsI TTSAA 2 cut(s) 56, 83
AleI CACNNNNGTG 1 cut(s) 135
AluBI AGCT 3 cut(s) 208, 325, 364
AluI AGCT 3 cut(s) 208, 325, 364
Alw21I GWGCWC 1 cut(s) 175
AlwI GGATC 2 cut(s) 124, 172
ApeKI GCWGC 1 cut(s) 194
Asp700I GAANNNNTTC 2 cut(s) 35, 78
BanII GRGCYC 1 cut(s) 130
BauI CACGAG 1 cut(s) 131
Bbv12I GWGCWC 1 cut(s) 175
BbvI GCAGC 1 cut(s) 181
BcgI CGANNNNNNTGC 2 cut(s) 122, 156
BfaI CTAG 2 cut(s) 144, 168
BfmI CTRYAG 1 cut(s) 159
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
BmsI GCATC 4 cut(s) 33, 130, 181, 246
BseXI GCAGC 1 cut(s) 181
BsiHKAI GWGCWC 1 cut(s) 175
Bsp1286I GDGCHC 2 cut(s) 130, 175
Bsp143I GATC 3 cut(s) 116, 164, 385
BspHI TCATGA 1 cut(s) 27
BspPI GGATC 2 cut(s) 124, 172
BssMI GATC 3 cut(s) 116, 164, 385
BssSI CACGAG 1 cut(s) 131
Bst2BI CACGAG 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 263
BstDEI CTNAG 1 cut(s) 198
BstKTI GATC 3 cut(s) 119, 167, 388
BstMBI GATC 3 cut(s) 116, 164, 385
BstSFI CTRYAG 1 cut(s) 159
BstV1I GCAGC 1 cut(s) 181
BstX2I RGATCY 2 cut(s) 116, 164
BstYI RGATCY 2 cut(s) 116, 164
BtsI GCAGTG 1 cut(s) 118
BtsIMutI CAGTG 2 cut(s) 118, 268
CciI TCATGA 1 cut(s) 27
CviAII CATG 2 cut(s) 28, 296
CviJI RGCY 7 cut(s) 5, 34, 128, 208, 325, 364, 381
CviKI_1 RGCY 7 cut(s) 5, 34, 128, 208, 325, 364, 381
DdeI CTNAG 1 cut(s) 198
DpnI GATC 3 cut(s) 118, 166, 387
DpnII GATC 3 cut(s) 116, 164, 385
Eco24I GRGCYC 1 cut(s) 130
EcoT38I GRGCYC 1 cut(s) 130
FaeI CATG 2 cut(s) 31, 299
FaiI YATR 4 cut(s) 29, 254, 297, 320
FatI CATG 2 cut(s) 27, 295
Fnu4HI GCNGC 1 cut(s) 195
FriOI GRGCYC 1 cut(s) 130
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 2 cut(s) 144, 168
GluI GCNGC 1 cut(s) 195
Hin1II CATG 2 cut(s) 31, 299
HinfI GANTC 4 cut(s) 52, 149, 292, 340
Hpy188I TCNGA 1 cut(s) 71
Hpy188III TCNNGA 4 cut(s) 28, 40, 105, 344
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4V TGCA 3 cut(s) 46, 259, 370
HpyF3I CTNAG 1 cut(s) 198
Hsp92II CATG 2 cut(s) 31, 299
Kzo9I GATC 3 cut(s) 116, 164, 385
LpnPI CCDG 2 cut(s) 53, 90
Lsp1109I GCAGC 1 cut(s) 181
LweI GCATC 4 cut(s) 33, 130, 181, 246
MaeI CTAG 2 cut(s) 144, 168
MaeIII GTNAC 1 cut(s) 146
MalI GATC 3 cut(s) 118, 166, 387
MboI GATC 3 cut(s) 116, 164, 385
MboII GAAGA 1 cut(s) 322
MfeI CAATTG 2 cut(s) 275, 374
MflI RGATCY 2 cut(s) 116, 164
MhlI GDGCHC 2 cut(s) 130, 175
MluCI AATT 3 cut(s) 275, 374, 397
MlyI GAGTC 2 cut(s) 143, 286
MmeI TCCRAC 3 cut(s) 49, 210, 219
MnlI CCTC 1 cut(s) 83
MroXI GAANNNNTTC 2 cut(s) 35, 78
MseI TTAA 2 cut(s) 282, 400
MslI CAYNNNNRTG 1 cut(s) 135
MunI CAATTG 2 cut(s) 275, 374
NdeII GATC 3 cut(s) 116, 164, 385
NlaIII CATG 2 cut(s) 31, 299
NmuCI GTSAC 1 cut(s) 146
OliI CACNNNNGTG 1 cut(s) 135
PagI TCATGA 1 cut(s) 27
PdmI GAANNNNTTC 2 cut(s) 35, 78
PfeI GAWTC 2 cut(s) 52, 340
PkrI GCNGC 1 cut(s) 196
PleI GAGTC 2 cut(s) 143, 286
PpsI GAGTC 2 cut(s) 143, 286
PsuI RGATCY 2 cut(s) 116, 164
RseI CAYNNNNRTG 1 cut(s) 135
SaqAI TTAA 2 cut(s) 282, 400
SatI GCNGC 1 cut(s) 195
Sau3AI GATC 3 cut(s) 116, 164, 385
SchI GAGTC 2 cut(s) 143, 286
SduI GDGCHC 2 cut(s) 130, 175
SetI ASST 4 cut(s) 210, 239, 327, 366
SfaNI GCATC 4 cut(s) 33, 130, 181, 246
SfcI CTRYAG 1 cut(s) 159
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 3 cut(s) 275, 374, 397
SspMI CTAG 2 cut(s) 144, 168
TaaI ACNGT 1 cut(s) 263
TaqI TCGA 1 cut(s) 345
TasI AATT 3 cut(s) 275, 374, 397
TfiI GAWTC 2 cut(s) 52, 340
Tru1I TTAA 2 cut(s) 282, 400
Tru9I TTAA 2 cut(s) 282, 400
TscAI CASTG 2 cut(s) 118, 268
TseFI GTSAC 1 cut(s) 146
TseI GCWGC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 146
TspDTI ATGAA 3 cut(s) 16, 44, 323
TspRI CASTG 2 cut(s) 118, 268
XcmI CCANNNNNNNNNTGG 1 cut(s) 389
XmnI GAANNNNTTC 2 cut(s) 35, 78
XspI CTAG 2 cut(s) 144, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.