AT3G29637

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0020215
Physical Location & Seq
Reverse (-)
11471115 .. 11472130
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G29637.2

Sequence Viewer

Length: 300 bp
ATGACTCTTGGAGGGATGACTGGTGCTGATGAAGACATTCCAAACAATGAAGATTCAACTTCTACTCGACGAAAAAGCCCCAAATGGACAACTAAGCAAAATTTGGTAGGAGGAAAAACGGGGTCTGGAAGCAGTGGATCTAAGAGAGCTCACAATCCTAATGCAAGTGACTCAAACTCTGTAGGATCTAGTGCTCGTCCCATGGGGAGGGATGCGTCTAAAAAGAAAGTTAAAAAAAAGGTAAGGGTGATGCATGCTTGGAAGTCGTTAATGAAGAGTGAAATGATTTCAAGCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

99

Amino Acids

10.58

Weight (kDa)

10.49

Isoelectric Point (pI)

41.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020215)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G36675 AT2G10975 AT3G29637 AT3G29637 AT3G29645 AT5G33390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 145, 193
AcsI RAATTY 1 cut(s) 100
AfiI CCNNNNNNNGG 1 cut(s) 207
AgsI TTSAA 2 cut(s) 57, 291
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Alw21I GWGCWC 2 cut(s) 151, 196
AlwI GGATC 2 cut(s) 145, 193
ApoI RAATTY 1 cut(s) 100
Asp700I GAANNNNTTC 1 cut(s) 36
AsuHPI GGTGA 1 cut(s) 259
BanII GRGCYC 1 cut(s) 151
BbsI GAAGAC 1 cut(s) 39
Bbv12I GWGCWC 2 cut(s) 151, 196
BfaI CTAG 1 cut(s) 189
BfmI CTRYAG 1 cut(s) 180
BmsI GCATC 2 cut(s) 202, 240
BpiI GAAGAC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 201
Bsc4I CCNNNNNNNGG 1 cut(s) 207
Bse1I ACTGG 1 cut(s) 25
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 2 cut(s) 21, 217
BseLI CCNNNNNNNGG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 25
BsiHKAI GWGCWC 2 cut(s) 151, 196
BslFI GGGAC 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 207
BsmFI GGGAC 1 cut(s) 183
Bsp1286I GDGCHC 2 cut(s) 151, 196
Bsp143I GATC 2 cut(s) 137, 185
Bsp19I CCATGG 1 cut(s) 201
BspPI GGATC 2 cut(s) 145, 193
BsrI ACTGG 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 2 cut(s) 137, 185
BssT1I CCWWGG 1 cut(s) 201
Bst6I CTCTTC 1 cut(s) 269
BstC8I GCNNGC 1 cut(s) 255
BstDEI CTNAG 2 cut(s) 93, 141
BstDSI CCRYGG 1 cut(s) 201
BstF5I GGATG 2 cut(s) 21, 217
BstKTI GATC 2 cut(s) 140, 188
BstMBI GATC 2 cut(s) 137, 185
BstNSI RCATGY 1 cut(s) 257
BstSFI CTRYAG 1 cut(s) 180
BstV2I GAAGAC 1 cut(s) 39
BstX2I RGATCY 2 cut(s) 137, 185
BstYI RGATCY 2 cut(s) 137, 185
BtgI CCRYGG 1 cut(s) 201
BtsCI GGATG 2 cut(s) 21, 217
BtsI GCAGTG 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 255
CseI GACGC 1 cut(s) 204
CviAII CATG 2 cut(s) 202, 254
CviJI RGCY 2 cut(s) 78, 149
CviKI_1 RGCY 2 cut(s) 78, 149
DdeI CTNAG 2 cut(s) 93, 141
DpnI GATC 2 cut(s) 139, 187
DpnII GATC 2 cut(s) 137, 185
Eam1104I CTCTTC 1 cut(s) 269
EarI CTCTTC 1 cut(s) 269
Ecl136II GAGCTC 1 cut(s) 149
Eco130I CCWWGG 1 cut(s) 201
Eco24I GRGCYC 1 cut(s) 151
Eco53kI GAGCTC 1 cut(s) 149
EcoICRI GAGCTC 1 cut(s) 149
EcoT14I CCWWGG 1 cut(s) 201
EcoT22I ATGCAT 1 cut(s) 255
EcoT38I GRGCYC 1 cut(s) 151
ErhI CCWWGG 1 cut(s) 201
FaeI CATG 2 cut(s) 205, 257
FaiI YATR 2 cut(s) 203, 255
FaqI GGGAC 1 cut(s) 183
FatI CATG 2 cut(s) 201, 253
FokI GGATG 2 cut(s) 28, 224
FriOI GRGCYC 1 cut(s) 151
FspBI CTAG 1 cut(s) 189
HgaI GACGC 1 cut(s) 204
Hin1II CATG 2 cut(s) 205, 257
HinfI GANTC 3 cut(s) 4, 53, 170
HphI GGTGA 1 cut(s) 259
Hpy188III TCNNGA 1 cut(s) 126
Hpy99I CGWCG 1 cut(s) 72
HpyCH4V TGCA 2 cut(s) 164, 253
HpyF3I CTNAG 2 cut(s) 93, 141
Hsp92II CATG 2 cut(s) 205, 257
Kzo9I GATC 2 cut(s) 137, 185
LpnPI CCDG 2 cut(s) 6, 111
LweI GCATC 2 cut(s) 202, 240
MaeI CTAG 1 cut(s) 189
MaeIII GTNAC 1 cut(s) 167
MalI GATC 2 cut(s) 139, 187
MboI GATC 2 cut(s) 137, 185
MboII GAAGA 3 cut(s) 44, 62, 286
MfeI CAATTG 1 cut(s) 295
MflI RGATCY 2 cut(s) 137, 185
MhlI GDGCHC 2 cut(s) 151, 196
MluCI AATT 2 cut(s) 100, 295
MlyI GAGTC 1 cut(s) 164
MnlI CCTC 3 cut(s) 5, 104, 201
Mph1103I ATGCAT 1 cut(s) 255
MroXI GAANNNNTTC 1 cut(s) 36
MseI TTAA 2 cut(s) 231, 269
MunI CAATTG 1 cut(s) 295
NcoI CCATGG 1 cut(s) 201
NdeII GATC 2 cut(s) 137, 185
NlaIII CATG 2 cut(s) 205, 257
NmuCI GTSAC 1 cut(s) 167
NsiI ATGCAT 1 cut(s) 255
NspI RCATGY 1 cut(s) 257
PaeI GCATGC 1 cut(s) 257
PdmI GAANNNNTTC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 53
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
Psp124BI GAGCTC 1 cut(s) 151
PsuI RGATCY 2 cut(s) 137, 185
SacI GAGCTC 1 cut(s) 151
SaqAI TTAA 2 cut(s) 231, 269
Sau3AI GATC 2 cut(s) 137, 185
SchI GAGTC 1 cut(s) 164
SduI GDGCHC 2 cut(s) 151, 196
SetI ASST 2 cut(s) 151, 243
SfaNI GCATC 2 cut(s) 202, 240
SfcI CTRYAG 1 cut(s) 180
SphI GCATGC 1 cut(s) 257
Sse9I AATT 2 cut(s) 100, 295
SspMI CTAG 1 cut(s) 189
SstI GAGCTC 1 cut(s) 151
StyI CCWWGG 1 cut(s) 201
TaqI TCGA 1 cut(s) 67
TasI AATT 2 cut(s) 100, 295
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 2 cut(s) 231, 269
Tru9I TTAA 2 cut(s) 231, 269
TscAI CASTG 1 cut(s) 139
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 3 cut(s) 45, 63, 287
TspRI CASTG 1 cut(s) 139
XapI RAATTY 1 cut(s) 100
XceI RCATGY 1 cut(s) 257
XmnI GAANNNNTTC 1 cut(s) 36
XspI CTAG 1 cut(s) 189
Zsp2I ATGCAT 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.