AT2G38905

Low temperature-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0018717
Physical Location & Seq
Reverse (-)
16244061 .. 16244531
471 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G38905.1

Sequence Viewer

Length: 165 bp
ATGGGATCAGAAACTTTCTTGGAAATTATTCTGGCGATTCTTCTACCTCCCGTCGGCGTTTTCCTTCGATATGGTTGTGGGGTAGAGTTCTGGATCTGTCTCTTGTTGACGATACTGGGTTACATCCCTGGGATCATCTATGCTATCTACGTTCTTGTCGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pmp3

Protein Analysis

54

Amino Acids

5.95

Weight (kDa)

4.25

Isoelectric Point (pI)

42.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 6 - 52 6.6e-23 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018717)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G38905
malus_domestica MD01G1131300.v1.1 MD07G1179400.v1.1
prunus_persica Prupe.2G218700_v2.0.a1
pyrus_communis pycom01g14010
rosa_chinensis RchiOBHm_Chr1g0364141
rosa_roxburghii Rroxscaffold_4G00292600
rosa_rugosa Rorug01G0313900
rosa_wichuraiana Rw1G028500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 13, 101, 140
AfiI CCNNNNNNNGG 1 cut(s) 53
AjnI CCWGG 1 cut(s) 127
Alw26I GTCTC 1 cut(s) 104
AlwI GGATC 3 cut(s) 13, 101, 140
Asp700I GAANNNNTTC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 129
BcoDI GTCTC 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 129
BmrI ACTGGG 1 cut(s) 125
BmuI ACTGGG 1 cut(s) 125
BsaJI CCNNGG 2 cut(s) 127, 128
Bsc4I CCNNNNNNNGG 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 129
BseDI CCNNGG 2 cut(s) 127, 128
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 53
BseNI ACTGG 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 104
Bsp143I GATC 3 cut(s) 5, 93, 132
BspPI GGATC 3 cut(s) 13, 101, 140
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 2 cut(s) 127, 128
BssMI GATC 3 cut(s) 5, 93, 132
Bst2UI CCWGG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 3 cut(s) 8, 96, 135
BstMAI GTCTC 1 cut(s) 104
BstMBI GATC 3 cut(s) 5, 93, 132
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BstX2I RGATCY 1 cut(s) 93
BstYI RGATCY 1 cut(s) 93
BtsCI GGATG 1 cut(s) 123
DpnI GATC 3 cut(s) 7, 95, 134
DpnII GATC 3 cut(s) 5, 93, 132
EcoRII CCWGG 1 cut(s) 127
FaiI YATR 2 cut(s) 72, 141
FokI GGATG 1 cut(s) 110
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HinfI GANTC 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 2 cut(s) 10, 161
Hpy188III TCNNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 108
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 74
HpyCH4IV ACGT 1 cut(s) 150
HpySE526I ACGT 1 cut(s) 150
Kzo9I GATC 3 cut(s) 5, 93, 132
LpnPI CCDG 5 cut(s) 17, 76, 101, 114, 141
MaeII ACGT 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 119
MalI GATC 3 cut(s) 7, 95, 134
MboI GATC 3 cut(s) 5, 93, 132
MboII GAAGA 1 cut(s) 32
MflI RGATCY 1 cut(s) 93
MluCI AATT 1 cut(s) 24
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 1 cut(s) 57
MroXI GAANNNNTTC 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
NdeII GATC 3 cut(s) 5, 93, 132
PasI CCCWGGG 1 cut(s) 128
PdmI GAANNNNTTC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
PsuI RGATCY 1 cut(s) 93
Sau3AI GATC 3 cut(s) 5, 93, 132
ScrFI CCNGG 1 cut(s) 129
SetI ASST 2 cut(s) 49, 153
SgeI CNNG 8 cut(s) 31, 44, 62, 103, 115, 128, 140, 141
Sse9I AATT 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 127
TaiI ACGT 1 cut(s) 153
TaqI TCGA 1 cut(s) 67
TasI AATT 1 cut(s) 24
TfiI GAWTC 1 cut(s) 37
XmnI GAANNNNTTC 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.