MD01G1131300.v1.1

Low temperature-induced protein lt101.2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0018717
Physical Location & Seq
Forward (+)
24176505 .. 24177087
583 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1131300.v1.1.491

Sequence Viewer

Length: 165 bp
ATGGGTTCAGAAACGTTTCTGGAAGTGATATTGGCAATCGTCCTCCCACCTGTGGGAGTCTTCCTTCGTTATGGCTGTGCAGTGGAGTTCTGGATATGTTTGTTGCTGACAATATTGGGATACATACCTGGAATCATATACGCATTATATGTACTCGTCGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pmp3

Protein Analysis

55

Amino Acids

5.93

Weight (kDa)

4.25

Isoelectric Point (pI)

33.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 6 - 52 5.8e-22 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018717)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G38905
malus_domestica MD01G1131300.v1.1 MD07G1179400.v1.1
prunus_persica Prupe.2G218700_v2.0.a1
pyrus_communis pycom01g14010
rosa_chinensis RchiOBHm_Chr1g0364141
rosa_roxburghii Rroxscaffold_4G00292600
rosa_rugosa Rorug01G0313900
rosa_wichuraiana Rw1G028500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 14
AfaI GTAC 1 cut(s) 153
AfiI CCNNNNNNNGG 2 cut(s) 52, 53
AjnI CCWGG 1 cut(s) 127
Asp700I GAANNNNTTC 1 cut(s) 15
BbsI GAAGAC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 129
BciVI GTATCC 1 cut(s) 113
BfuI GTATCC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 129
BpiI GAAGAC 1 cut(s) 52
Bsc4I CCNNNNNNNGG 2 cut(s) 52, 53
BseBI CCWGG 1 cut(s) 129
BseLI CCNNNNNNNGG 2 cut(s) 52, 53
BsgI GTGCAG 1 cut(s) 99
BslI CCNNNNNNNGG 2 cut(s) 52, 53
Bst2UI CCWGG 1 cut(s) 129
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 52
BsuI GTATCC 1 cut(s) 113
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 1 cut(s) 87
Csp6I GTAC 1 cut(s) 152
CviJI RGCY 1 cut(s) 75
CviKI_1 RGCY 1 cut(s) 75
CviQI GTAC 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 127
FaiI YATR 7 cut(s) 72, 97, 125, 137, 139, 148, 150
HinfI GANTC 2 cut(s) 57, 132
Hpy188I TCNGA 2 cut(s) 10, 161
Hpy188III TCNNGA 2 cut(s) 20, 91
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 74
HpyCH4IV ACGT 1 cut(s) 14
HpyCH4V TGCA 1 cut(s) 80
HpySE526I ACGT 1 cut(s) 14
LpnPI CCDG 5 cut(s) 5, 63, 76, 114, 141
MaeII ACGT 1 cut(s) 14
MboII GAAGA 1 cut(s) 52
MlyI GAGTC 1 cut(s) 66
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 1 cut(s) 53
MroXI GAANNNNTTC 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
PdmI GAANNNNTTC 1 cut(s) 15
PfeI GAWTC 1 cut(s) 132
PleI GAGTC 1 cut(s) 65
PpsI GAGTC 1 cut(s) 65
Psp1406I AACGTT 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
RsaI GTAC 1 cut(s) 153
RsaNI GTAC 1 cut(s) 152
SchI GAGTC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 129
SetI ASST 3 cut(s) 17, 52, 130
SgeI CNNG 5 cut(s) 32, 62, 103, 140, 141
SspI AATATT 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 127
TaiI ACGT 1 cut(s) 17
TatI WGTACW 1 cut(s) 151
TfiI GAWTC 1 cut(s) 132
TscAI CASTG 1 cut(s) 87
TspRI CASTG 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.