AT3G28455

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
10669725 .. 10671645
1921 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G28455.1

Sequence Viewer

Length: 246 bp
ATGGGTGGAAATGGCATTAGAGCTTTGGTTGGAGTGATTGCATCTTTGGGTTTGATTGTGTTTCTTCTTGTCGGTATCTTAGCAAACTCTGCACCAAGTGTTCCATCATCAGAAAATGTCAAGACTTTGCGGTTTAGTGGTAAGGATGTGAATCTGTTTCATGTAAGCAAGCGAAAAGTTCCTAATGGACCTGATCCTATCCACAACAGGAAAGCAGAAACTTCGAGACGGCCACCAAGAGTATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.62

Weight (kDa)

11.64

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017152)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G28455
fragaria_vesca FvH4_6g49680
malus_domestica MD09G1042500.v1.1 MD17G1044000.v1.1
prunus_persica Prupe.3G275200_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0169701
rosa_multiflora Rmu_ssc0000220.1_g000001
rosa_roxburghii Rroxscaffold_2G00081870
rosa_rugosa Rorug02G0542300
rosa_samantha Rh2AG614600 Rh2CG596300 Rh2DG637700
rosa_wichuraiana Rw2G050950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 130
AclWI GGATC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 230
AdeI CACNNNGTG 1 cut(s) 98
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Alw26I GTCTC 1 cut(s) 220
AlwI GGATC 1 cut(s) 188
AoxI GGCC 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 188
AvaII GGWCC 1 cut(s) 188
BccI CCATC 1 cut(s) 112
BcgI CGANNNNNNTGC 2 cut(s) 204, 238
BcoDI GTCTC 1 cut(s) 220
Bme18I GGWCC 1 cut(s) 188
BmgT120I GGNCC 1 cut(s) 188
BmsI GCATC 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 150
Bse8I GATNNNNATC 1 cut(s) 150
BseGI GGATG 1 cut(s) 151
BseJI GATNNNNATC 1 cut(s) 150
BsgI GTGCAG 1 cut(s) 75
BshFI GGCC 1 cut(s) 232
BsmAI GTCTC 1 cut(s) 220
BsmBI CGTCTC 1 cut(s) 220
BsnI GGCC 1 cut(s) 232
Bsp143I GATC 1 cut(s) 193
BspACI CCGC 1 cut(s) 130
BspANI GGCC 1 cut(s) 232
BspPI GGATC 1 cut(s) 188
BssMI GATC 1 cut(s) 193
BstAPI GCANNNNNTGC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 79
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 1 cut(s) 196
BstMAI GTCTC 1 cut(s) 220
BstMBI GATC 1 cut(s) 193
BstMWI GCNNNNNNNGC 1 cut(s) 89
BsuRI GGCC 1 cut(s) 232
BtsCI GGATG 1 cut(s) 151
Cac8I GCNNGC 1 cut(s) 170
Cfr13I GGNCC 1 cut(s) 188
CviAII CATG 1 cut(s) 161
CviJI RGCY 2 cut(s) 23, 232
CviKI_1 RGCY 2 cut(s) 23, 232
DdeI CTNAG 1 cut(s) 79
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
DraIII CACNNNGTG 1 cut(s) 98
EaeI YGGCCR 1 cut(s) 230
Eco47I GGWCC 1 cut(s) 188
Esp3I CGTCTC 1 cut(s) 220
FaeI CATG 1 cut(s) 164
FaiI YATR 2 cut(s) 162, 244
FatI CATG 1 cut(s) 160
FokI GGATG 1 cut(s) 158
HaeIII GGCC 1 cut(s) 232
Hin1II CATG 1 cut(s) 164
HinfI GANTC 1 cut(s) 151
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 2 cut(s) 121, 225
HpyCH4V TGCA 2 cut(s) 41, 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 79
Hsp92II CATG 1 cut(s) 164
Kzo9I GATC 1 cut(s) 193
LpnPI CCDG 2 cut(s) 193, 204
LweI GCATC 1 cut(s) 50
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 1 cut(s) 56
MmeI TCCRAC 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 1 cut(s) 193
NlaIII CATG 1 cut(s) 164
PfeI GAWTC 1 cut(s) 151
PspPI GGNCC 1 cut(s) 188
Sau3AI GATC 1 cut(s) 193
Sau96I GGNCC 1 cut(s) 188
SetI ASST 2 cut(s) 25, 193
SfaNI GCATC 1 cut(s) 50
SgeI CNNG 8 cut(s) 80, 108, 133, 173, 181, 203, 220, 237
SinI GGWCC 1 cut(s) 188
SsiI CCGC 1 cut(s) 130
TaqI TCGA 1 cut(s) 224
TfiI GAWTC 1 cut(s) 151
TspDTI ATGAA 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.