AT5G18037

No apical meristem (NAM) protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0020191
Physical Location & Seq
Reverse (-)
5971101 .. 5971566
466 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G18037.1

Sequence Viewer

Length: 216 bp
ATGTCGATGGTTAAGTACTACGATAAAGAGGAACATGTTGGGTTTTGGTTTCATCCTTCTGCCCAAGAACTCATCATCCGTTATATCGGGCCTAAGGTTACCAAAAGATCAAATAAAGAATTTGAATTAGAAGACAAGTTTGACATCTATGCCAAAGAGCCGTGGCGGTTGTCTCACACCGAGACTAACTTTTTGGAACCTAATGAATGGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

71

Amino Acids

8.76

Weight (kDa)

5.55

Isoelectric Point (pI)

44.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 13 - 71 4.8e-08 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020191)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G03490 AT1G19040 AT1G35890 AT3G46565 AT5G18037 AT5G18300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 119
AfaI GTAC 1 cut(s) 17
AflIII ACRYGT 1 cut(s) 34
AgsI TTSAA 1 cut(s) 125
AloI GAACNNNNNNTCC 2 cut(s) 60, 92
Alw26I GTCTC 2 cut(s) 176, 177
AoxI GGCC 1 cut(s) 89
ApoI RAATTY 1 cut(s) 119
ArsI GACNNNNNNTTYG 2 cut(s) 175, 207
AspS9I GGNCC 1 cut(s) 89
AxyI CCTNAGG 1 cut(s) 93
BbsI GAAGAC 1 cut(s) 138
BceAI ACGGC 1 cut(s) 145
BcoDI GTCTC 2 cut(s) 176, 177
BfaI CTAG 1 cut(s) 214
BmcAI AGTACT 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 198
BpiI GAAGAC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 161
Bse21I CCTNAGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 161
BseGI GGATG 2 cut(s) 52, 75
BshFI GGCC 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 176, 177
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 107
BspACI CCGC 1 cut(s) 166
BspANI GGCC 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 161
BssMI GATC 1 cut(s) 107
BstDEI CTNAG 1 cut(s) 93
BstDSI CCRYGG 1 cut(s) 161
BstEII GGTNACC 1 cut(s) 97
BstF5I GGATG 2 cut(s) 52, 75
BstKTI GATC 1 cut(s) 110
BstMAI GTCTC 2 cut(s) 176, 177
BstMBI GATC 1 cut(s) 107
BstNSI RCATGY 1 cut(s) 38
BstPI GGTNACC 1 cut(s) 97
BstV2I GAAGAC 1 cut(s) 138
Bsu36I CCTNAGG 1 cut(s) 93
BsuRI GGCC 1 cut(s) 91
BtgI CCRYGG 1 cut(s) 161
BtsCI GGATG 2 cut(s) 52, 75
Cfr13I GGNCC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 16
CviAII CATG 1 cut(s) 35
CviJI RGCY 2 cut(s) 91, 160
CviKI_1 RGCY 2 cut(s) 91, 160
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
Eco81I CCTNAGG 1 cut(s) 93
Eco91I GGTNACC 1 cut(s) 97
EcoO65I GGTNACC 1 cut(s) 97
FaeI CATG 1 cut(s) 38
FaiI YATR 3 cut(s) 36, 84, 150
FatI CATG 1 cut(s) 34
FokI GGATG 2 cut(s) 39, 62
FspBI CTAG 1 cut(s) 214
HaeIII GGCC 1 cut(s) 91
Hin1II CATG 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 1 cut(s) 38
Kzo9I GATC 1 cut(s) 107
MaeI CTAG 1 cut(s) 214
MaeIII GTNAC 1 cut(s) 97
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MboII GAAGA 1 cut(s) 143
MluCI AATT 2 cut(s) 119, 125
MnlI CCTC 1 cut(s) 22
MseI TTAA 1 cut(s) 12
NdeII GATC 1 cut(s) 107
NlaIII CATG 1 cut(s) 38
NlaIV GGNNCC 1 cut(s) 198
NspI RCATGY 1 cut(s) 38
PciI ACATGT 1 cut(s) 34
PscI ACATGT 1 cut(s) 34
PspEI GGTNACC 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 198
PspPI GGNCC 1 cut(s) 89
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 107
Sau96I GGNCC 1 cut(s) 89
ScaI AGTACT 1 cut(s) 17
SetI ASST 2 cut(s) 99, 202
SgeI CNNG 6 cut(s) 47, 77, 100, 148, 174, 193
Sse9I AATT 2 cut(s) 119, 125
SsiI CCGC 1 cut(s) 166
SspMI CTAG 1 cut(s) 214
TaqI TCGA 1 cut(s) 5
TasI AATT 2 cut(s) 119, 125
TatI WGTACW 1 cut(s) 15
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 41
TspGWI ACGGA 1 cut(s) 68
XapI RAATTY 1 cut(s) 119
XceI RCATGY 1 cut(s) 38
XspI CTAG 1 cut(s) 214
ZrmI AGTACT 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.