AT5G26749

Zinc finger CCCH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0009169
Physical Location & Seq
Reverse (-)
9398015 .. 9399267
1253 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G26749.1

Sequence Viewer

Length: 444 bp
ATGCCGTCGGGGAAATATTACTGTGATTATTGCGAGAAAGAGTTTCAAGACACTCAAGTCGCTAGAAAACGCCATCTTCAAAGCAAACCTCATCTTCGAGCTAAAGCCCTTTGGTACAGTTCTTCTTCCTCAGATCTTGTTAATCCACAAGTCTCCAATTTTGCGACGAAAGGTCTCTGCAATCGATTCATTACCTCGAATTTTTGCCCATTTGGAGATTCTTGCAGATACTTCCATCCTAACAACAATACAGGAAGCACAGGATTCACAAATAATACACAACTTCGTGTTGACATGCTTAACCAACAACACATCCAAGGAAGTACTTTAAACCGTGATTTTGTTAGTGGGAGACCAGGAACAGGTTGGTTTGATCTTCCGCCATCGCTAAAACCGCCTCCTGAGCAAGGCTATCCTCAGCTTCCCTTCATAGACTGGGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005681 GO:0005689 GO:0032991 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:1990904
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-CCCH zf-U1

Protein Analysis

147

Amino Acids

16.73

Weight (kDa)

8.87

Isoelectric Point (pI)

47.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-U1 PF06220 5 - 37 3.4e-08 U1 zinc finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 56
AciI CCGC 2 cut(s) 380, 395
AcsI RAATTY 1 cut(s) 199
AfaI GTAC 2 cut(s) 116, 325
AfiI CCNNNNNNNGG 2 cut(s) 362, 407
AgsI TTSAA 2 cut(s) 47, 80
AhdI GACNNNNNGTC 1 cut(s) 171
AjnI CCWGG 1 cut(s) 355
AluBI AGCT 2 cut(s) 101, 421
AluI AGCT 2 cut(s) 101, 421
Alw26I GTCTC 3 cut(s) 157, 179, 346
ApoI RAATTY 1 cut(s) 199
BbvCI CCTCAGC 1 cut(s) 417
BccI CCATC 3 cut(s) 81, 243, 391
BciT130I CCWGG 1 cut(s) 357
BcoDI GTCTC 3 cut(s) 157, 179, 346
BfaI CTAG 1 cut(s) 63
BglII AGATCT 1 cut(s) 133
BmcAI AGTACT 1 cut(s) 325
Bme1390I CCNGG 1 cut(s) 357
BmeRI GACNNNNNGTC 1 cut(s) 171
BmrFI CCNGG 1 cut(s) 357
Bpu10I CCTNAGC 2 cut(s) 402, 417
BpuEI CTTGAG 1 cut(s) 39
Bsa29I ATCGAT 1 cut(s) 184
BsaI GGTCTC 2 cut(s) 179, 346
BsaJI CCNNGG 1 cut(s) 316
Bsc4I CCNNNNNNNGG 2 cut(s) 362, 407
Bse1I ACTGG 1 cut(s) 440
BseBI CCWGG 1 cut(s) 357
BseCI ATCGAT 1 cut(s) 184
BseDI CCNNGG 1 cut(s) 316
BseGI GGATG 2 cut(s) 235, 312
BseLI CCNNNNNNNGG 2 cut(s) 362, 407
BseMII CTCAG 3 cut(s) 144, 393, 431
BseNI ACTGG 1 cut(s) 440
BshVI ATCGAT 1 cut(s) 184
BslI CCNNNNNNNGG 2 cut(s) 362, 407
BsmAI GTCTC 3 cut(s) 157, 179, 346
Bso31I GGTCTC 2 cut(s) 179, 346
Bsp143I GATC 2 cut(s) 133, 373
BspACI CCGC 2 cut(s) 380, 395
BspCNI CTCAG 3 cut(s) 143, 394, 430
BspDI ATCGAT 1 cut(s) 184
BspTNI GGTCTC 2 cut(s) 179, 346
BsrI ACTGG 1 cut(s) 440
BssECI CCNNGG 1 cut(s) 316
BssMI GATC 2 cut(s) 133, 373
BssT1I CCWWGG 1 cut(s) 316
Bst2UI CCWGG 1 cut(s) 357
Bst4CI ACNGT 3 cut(s) 23, 119, 335
BstDEI CTNAG 3 cut(s) 130, 402, 417
BstENI CCTNNNNNAGG 1 cut(s) 405
BstF5I GGATG 2 cut(s) 235, 312
BstKTI GATC 2 cut(s) 136, 376
BstMAI GTCTC 3 cut(s) 157, 179, 346
BstMBI GATC 2 cut(s) 133, 373
BstMWI GCNNNNNNNGC 2 cut(s) 394, 403
BstNI CCWGG 1 cut(s) 357
BstNSI RCATGY 1 cut(s) 298
BstSCI CCNGG 1 cut(s) 355
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
Bsu15I ATCGAT 1 cut(s) 184
BsuTUI ATCGAT 1 cut(s) 184
BtgZI GCGATG 1 cut(s) 369
BtsCI GGATG 2 cut(s) 235, 312
ClaI ATCGAT 1 cut(s) 184
Csp6I GTAC 2 cut(s) 115, 324
CviAII CATG 1 cut(s) 295
CviJI RGCY 4 cut(s) 101, 107, 411, 421
CviKI_1 RGCY 4 cut(s) 101, 107, 411, 421
CviQI GTAC 2 cut(s) 115, 324
DdeI CTNAG 3 cut(s) 130, 402, 417
DpnI GATC 2 cut(s) 135, 375
DpnII GATC 2 cut(s) 133, 373
DraI TTTAAA 1 cut(s) 330
DrdI GACNNNNNNGTC 1 cut(s) 56
DriI GACNNNNNGTC 1 cut(s) 171
DseDI GACNNNNNNGTC 1 cut(s) 56
Eam1105I GACNNNNNGTC 1 cut(s) 171
EciI GGCGGA 1 cut(s) 369
Eco130I CCWWGG 1 cut(s) 316
Eco31I GGTCTC 2 cut(s) 179, 346
EcoNI CCTNNNNNAGG 1 cut(s) 405
EcoRII CCWGG 1 cut(s) 355
EcoT14I CCWWGG 1 cut(s) 316
ErhI CCWWGG 1 cut(s) 316
FaeI CATG 1 cut(s) 298
FaiI YATR 2 cut(s) 296, 431
FatI CATG 1 cut(s) 294
FokI GGATG 2 cut(s) 222, 299
FspBI CTAG 1 cut(s) 63
Hin1II CATG 1 cut(s) 298
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HinfI GANTC 3 cut(s) 186, 218, 264
Hpy166II GTNNAC 1 cut(s) 292
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 47, 401
Hpy8I GTNNAC 1 cut(s) 292
Hpy99I CGWCG 2 cut(s) 10, 169
HpyAV CCTTC 1 cut(s) 436
HpyCH4III ACNGT 3 cut(s) 23, 119, 335
HpyCH4V TGCA 2 cut(s) 180, 225
HpyF10VI GCNNNNNNNGC 2 cut(s) 394, 403
HpyF3I CTNAG 3 cut(s) 130, 402, 417
Hsp92II CATG 1 cut(s) 298
Kzo9I GATC 2 cut(s) 133, 373
LpnPI CCDG 7 cut(s) 237, 246, 342, 348, 369, 414, 421
MaeI CTAG 1 cut(s) 63
MalI GATC 2 cut(s) 135, 375
MboI GATC 2 cut(s) 133, 373
MboII GAAGA 5 cut(s) 68, 86, 114, 117, 368
MflI RGATCY 1 cut(s) 133
MluCI AATT 2 cut(s) 157, 199
MnlI CCTC 5 cut(s) 99, 139, 205, 408, 426
MseI TTAA 3 cut(s) 141, 300, 329
MspR9I CCNGG 1 cut(s) 357
MvaI CCWGG 1 cut(s) 357
MwoI GCNNNNNNNGC 2 cut(s) 394, 403
NdeII GATC 2 cut(s) 133, 373
NlaIII CATG 1 cut(s) 298
NspI RCATGY 1 cut(s) 298
PfeI GAWTC 3 cut(s) 186, 218, 264
Psp6I CCWGG 1 cut(s) 355
PspGI CCWGG 1 cut(s) 355
PsuI RGATCY 1 cut(s) 133
RsaI GTAC 2 cut(s) 116, 325
RsaNI GTAC 2 cut(s) 115, 324
SaqAI TTAA 3 cut(s) 141, 300, 329
Sau3AI GATC 2 cut(s) 133, 373
ScaI AGTACT 1 cut(s) 325
ScrFI CCNGG 1 cut(s) 357
SetI ASST 6 cut(s) 91, 103, 175, 197, 367, 423
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
Sse9I AATT 2 cut(s) 157, 199
SsiI CCGC 2 cut(s) 380, 395
SspI AATATT 1 cut(s) 17
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 1 cut(s) 355
StyI CCWWGG 1 cut(s) 316
TaaI ACNGT 3 cut(s) 23, 119, 335
TaqI TCGA 3 cut(s) 97, 184, 197
TasI AATT 2 cut(s) 157, 199
TatI WGTACW 1 cut(s) 323
TfiI GAWTC 3 cut(s) 186, 218, 264
Tru1I TTAA 3 cut(s) 141, 300, 329
Tru9I TTAA 3 cut(s) 141, 300, 329
TspDTI ATGAA 2 cut(s) 178, 418
XagI CCTNNNNNAGG 1 cut(s) 405
XapI RAATTY 1 cut(s) 199
XceI RCATGY 1 cut(s) 298
XcmI CCANNNNNNNNNTGG 1 cut(s) 363
XspI CTAG 1 cut(s) 63
ZrmI AGTACT 1 cut(s) 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.