AT5G39690

No apical meristem (NAM) protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0019601
Physical Location & Seq
Forward (+)
15888171 .. 15890187
2017 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G39690.1

Sequence Viewer

Length: 885 bp
ATGGCTAAGAAAGAGAAGATCGAGCAAGTGATTTCAATGGGTGGAATAATGTGGGAAGGTCTCAATTCGAGTTTAATCAAAGTCGATGAAGCTTTGCTTAAGCAGCAGATCCGAGAATTCGAGAAGGGTAACGATAAAGAATGGTTTATTATAACGGAGAGGAACAAAGTTGATCAAGGTTTAAGCCAAACAAAGAGAGTTGGTAATGGTGCGAAAAGGCAGAAACGTGTTGACACTAACGGAGGATATTGGCACGCAACAGTGGCTGCCCAAAAGATCAACGCTGGAGATGGTGTCGTTGGCAACAAAAGGCCACTTGCATACTACGATAGGAAACCATCAGAAGACGTCAAAACTGATTGGTTAATGCAAGAATACTCTCTTGATCACAACAACGACAAGGTAAGATTACACTTTGTGCAAGATTTATCTTACTCCACAAGCAACAAAGAAGTTGGAGAAGAGAAGAAGAAGCAGAAGAAAGGAGAACCTGTGGAAGCATCGGAAGGGCAGCAGCCTTGTAATGCCGAGTATCATCAACCGCTAGCACCTCTAGATTCTTGCCAACCGCAGCCTCATGATTTGGCTGAGCAGCTGGATTTGCATCAACCAGAACAGTTGCAGCTGCAACAGCCTCATGATATTGTGTATCAACCACAGTATTGTTTACTTCCAGAACAACATCAGCTGCAGCCTTTTCCTGATAACTTTTCTGAGTTGAACAGCTTTCAACAGCAACCAGTGATGATCCCAGACGATTTAGAAGATTTCTTGGCTGAATTAATGGAGCCACATTCACTGGATGGAGATGAAGAATCCAACAATTATGGGTTTTTTGAAGGCTTATTTGACACAGAAGGAATTAATGATAAAACATTACACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

294

Amino Acids

33.73

Weight (kDa)

4.87

Isoelectric Point (pI)

46.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 37 - 128 1.1e-13 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019601)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G32337 AT3G46390 AT3G55210 AT3G56530 AT3G56560 AT5G39540 AT5G39690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 152
AatII GACGTC 1 cut(s) 351
AciI CCGC 2 cut(s) 542, 569
AclWI GGATC 2 cut(s) 103, 742
AcsI RAATTY 1 cut(s) 116
AcyI GRCGYC 1 cut(s) 348
AdeI CACNNNGTG 1 cut(s) 418
AflII CTTAAG 1 cut(s) 98
AflIII ACRYGT 1 cut(s) 226
AgsI TTSAA 4 cut(s) 36, 721, 731, 839
AluBI AGCT 5 cut(s) 92, 595, 625, 688, 726
AluI AGCT 5 cut(s) 92, 595, 625, 688, 726
Alw26I GTCTC 1 cut(s) 65
AlwI GGATC 2 cut(s) 103, 742
AlwNI CAGNNNCTG 1 cut(s) 266
AoxI GGCC 1 cut(s) 311
ApoI RAATTY 1 cut(s) 116
AseI ATTAAT 2 cut(s) 782, 864
AsuNHI GCTAGC 1 cut(s) 544
BbsI GAAGAC 1 cut(s) 351
BccI CCATC 3 cut(s) 284, 346, 797
BclI TGATCA 2 cut(s) 172, 385
BcoDI GTCTC 1 cut(s) 65
BfaI CTAG 2 cut(s) 545, 554
BfmI CTRYAG 1 cut(s) 689
BfrI CTTAAG 1 cut(s) 98
BlpI GCTNAGC 1 cut(s) 588
BmiI GGNNCC 1 cut(s) 789
BmsI GCATC 2 cut(s) 509, 613
BmtI GCTAGC 1 cut(s) 548
BpiI GAAGAC 1 cut(s) 351
BpmI CTGGAG 1 cut(s) 306
Bpu1102I GCTNAGC 1 cut(s) 588
BsaBI GATNNNNATC 1 cut(s) 603
BsaHI GRCGYC 1 cut(s) 348
BsaI GGTCTC 1 cut(s) 65
BsaXI ACNNNNNCTCC 4 cut(s) 279, 309, 477, 507
Bse1I ACTGG 2 cut(s) 740, 804
Bse8I GATNNNNATC 1 cut(s) 603
BseGI GGATG 1 cut(s) 808
BseJI GATNNNNATC 1 cut(s) 603
BseMII CTCAG 2 cut(s) 579, 705
BseNI ACTGG 2 cut(s) 740, 804
BshFI GGCC 1 cut(s) 313
BsmAI GTCTC 1 cut(s) 65
BsnI GGCC 1 cut(s) 313
Bso31I GGTCTC 1 cut(s) 65
Bsp143I GATC 6 cut(s) 18, 108, 172, 276, 385, 747
Bsp1720I GCTNAGC 1 cut(s) 588
BspACI CCGC 2 cut(s) 542, 569
BspANI GGCC 1 cut(s) 313
BspCNI CTCAG 2 cut(s) 580, 706
BspHI TCATGA 2 cut(s) 577, 637
BspLI GGNNCC 1 cut(s) 789
BspMAI CTGCAG 1 cut(s) 693
BspOI GCTAGC 1 cut(s) 548
BspPI GGATC 2 cut(s) 103, 742
BspTI CTTAAG 1 cut(s) 98
BspTNI GGTCTC 1 cut(s) 65
BsrI ACTGG 2 cut(s) 740, 804
BssMI GATC 6 cut(s) 18, 108, 172, 276, 385, 747
BssNI GRCGYC 1 cut(s) 348
Bst4CI ACNGT 3 cut(s) 262, 618, 660
Bst6I CTCTTC 1 cut(s) 456
BstACI GRCGYC 1 cut(s) 348
BstAFI CTTAAG 1 cut(s) 98
BstC8I GCNNGC 2 cut(s) 255, 546
BstDEI CTNAG 3 cut(s) 6, 588, 714
BstF5I GGATG 1 cut(s) 808
BstKTI GATC 6 cut(s) 21, 111, 175, 279, 388, 750
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 6 cut(s) 18, 108, 172, 276, 385, 747
BstMWI GCNNNNNNNGC 4 cut(s) 103, 263, 601, 631
BstSFI CTRYAG 1 cut(s) 689
BstV2I GAAGAC 1 cut(s) 351
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
BsuRI GGCC 1 cut(s) 313
BtsCI GGATG 1 cut(s) 808
BtsIMutI CAGTG 3 cut(s) 267, 747, 797
Cac8I GCNNGC 2 cut(s) 255, 546
CaiI CAGNNNCTG 1 cut(s) 266
CciI TCATGA 2 cut(s) 577, 637
CviAII CATG 2 cut(s) 578, 638
DdeI CTNAG 3 cut(s) 6, 588, 714
DpnI GATC 6 cut(s) 20, 110, 174, 278, 387, 749
DpnII GATC 6 cut(s) 18, 108, 172, 276, 385, 747
DraIII CACNNNGTG 1 cut(s) 418
Eam1104I CTCTTC 1 cut(s) 456
EarI CTCTTC 1 cut(s) 456
Eco31I GGTCTC 1 cut(s) 65
EcoRI GAATTC 1 cut(s) 116
FaeI CATG 2 cut(s) 581, 641
FaiI YATR 5 cut(s) 152, 322, 579, 639, 828
FalI AAGNNNNNCTT 2 cut(s) 81, 113
FatI CATG 2 cut(s) 577, 637
FbaI TGATCA 2 cut(s) 172, 385
FokI GGATG 1 cut(s) 815
FspBI CTAG 2 cut(s) 545, 554
GsuI CTGGAG 1 cut(s) 306
HaeIII GGCC 1 cut(s) 313
Hin1I GRCGYC 1 cut(s) 348
Hin1II CATG 2 cut(s) 581, 641
HincII GTYRAC 1 cut(s) 232
HindII GTYRAC 1 cut(s) 232
HindIII AAGCTT 1 cut(s) 90
HinfI GANTC 2 cut(s) 557, 815
Hpy166II GTNNAC 2 cut(s) 232, 668
Hpy188I TCNGA 4 cut(s) 113, 343, 505, 715
Hpy188III TCNNGA 7 cut(s) 121, 383, 554, 578, 638, 674, 701
Hpy8I GTNNAC 2 cut(s) 232, 668
HpyAV CCTTC 5 cut(s) 50, 118, 500, 833, 851
HpyCH4III ACNGT 3 cut(s) 262, 618, 660
HpyCH4IV ACGT 2 cut(s) 226, 348
HpyCH4V TGCA 7 cut(s) 320, 370, 421, 604, 622, 628, 691
HpyF10VI GCNNNNNNNGC 4 cut(s) 103, 263, 601, 631
HpyF3I CTNAG 3 cut(s) 6, 588, 714
HpySE526I ACGT 2 cut(s) 226, 348
Hsp92I GRCGYC 1 cut(s) 348
Hsp92II CATG 2 cut(s) 581, 641
Ksp22I TGATCA 2 cut(s) 172, 385
Kzo9I GATC 6 cut(s) 18, 108, 172, 276, 385, 747
LmnI GCTCC 1 cut(s) 787
LpnPI CCDG 9 cut(s) 270, 504, 581, 624, 687, 714, 753, 765, 785
LweI GCATC 2 cut(s) 509, 613
MaeI CTAG 2 cut(s) 545, 554
MaeII ACGT 2 cut(s) 226, 348
MaeIII GTNAC 1 cut(s) 128
MalI GATC 6 cut(s) 20, 110, 174, 278, 387, 749
MboI GATC 6 cut(s) 18, 108, 172, 276, 385, 747
MboII GAAGA 8 cut(s) 28, 356, 473, 478, 481, 490, 776, 824
MflI RGATCY 1 cut(s) 108
MluCI AATT 5 cut(s) 64, 116, 779, 823, 861
MmeI TCCRAC 2 cut(s) 436, 843
MnlI CCTC 5 cut(s) 153, 236, 561, 585, 645
MseI TTAA 6 cut(s) 74, 99, 182, 365, 782, 864
MspA1I CMGCKG 3 cut(s) 595, 625, 688
MspCI CTTAAG 1 cut(s) 98
MwoI GCNNNNNNNGC 4 cut(s) 103, 263, 601, 631
NdeII GATC 6 cut(s) 18, 108, 172, 276, 385, 747
NheI GCTAGC 1 cut(s) 544
NlaIII CATG 2 cut(s) 581, 641
NlaIV GGNNCC 1 cut(s) 789
NmeAIII GCCGAG 1 cut(s) 553
PagI TCATGA 2 cut(s) 577, 637
PfeI GAWTC 2 cut(s) 557, 815
PshBI ATTAAT 2 cut(s) 782, 864
PsiI TTATAA 1 cut(s) 152
PspN4I GGNNCC 1 cut(s) 789
PstI CTGCAG 1 cut(s) 693
PstNI CAGNNNCTG 1 cut(s) 266
PsuI RGATCY 1 cut(s) 108
PvuII CAGCTG 3 cut(s) 595, 625, 688
SaqAI TTAA 6 cut(s) 74, 99, 182, 365, 782, 864
Sau3AI GATC 6 cut(s) 18, 108, 172, 276, 385, 747
SfaNI GCATC 2 cut(s) 509, 613
SfcI CTRYAG 1 cut(s) 689
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 5 cut(s) 64, 116, 779, 823, 861
SsiI CCGC 2 cut(s) 542, 569
SspMI CTAG 2 cut(s) 545, 554
TaaI ACNGT 3 cut(s) 262, 618, 660
TaiI ACGT 2 cut(s) 229, 351
TaqI TCGA 4 cut(s) 21, 68, 84, 120
TasI AATT 5 cut(s) 64, 116, 779, 823, 861
TfiI GAWTC 2 cut(s) 557, 815
Tru1I TTAA 6 cut(s) 74, 99, 182, 365, 782, 864
Tru9I TTAA 6 cut(s) 74, 99, 182, 365, 782, 864
TscAI CASTG 3 cut(s) 267, 747, 804
TspDTI ATGAA 2 cut(s) 102, 825
TspGWI ACGGA 2 cut(s) 170, 255
TspRI CASTG 3 cut(s) 267, 747, 804
Vha464I CTTAAG 1 cut(s) 98
VspI ATTAAT 2 cut(s) 782, 864
XapI RAATTY 1 cut(s) 116
XbaI TCTAGA 1 cut(s) 553
XspI CTAG 2 cut(s) 545, 554
ZraI GACGTC 1 cut(s) 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.