ATCG00660

Binds directly to 23S ribosomal RNA and is necessary for the in vitro assembly process of the 50S ribosomal subunit. It is not involved in the protein synthesizing functions of that subunit

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
Physical Location & Seq
Reverse (-)
68512 .. 68865
354 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00660.1

Sequence Viewer

Length: 354 bp
ATGACTAGAATTAAACGCGGATATATAGCTCGGAGGCGTAGAACAAAACTTCGTTTATTTGCATCAAGCTTTCGAGGGGCTCATTCACGGCTTACACGAACTATGACTCAACAGAGAATAAGAGCTTTAGTTTCGGCTCATCGGGATAGGGGTAAAAGAAAAAGAGATTTTCGCCGTTTATGGATCACTCGAATAAATGCCGTAATTCACGAAATGGGGGTATTCTATAGTTATAATGAATTCATACACAATCTATACAAGAAGCAATTACTTCTTAATCGGAAAATACTTGCACAAATAGCTCTATTAAATAGGAGTTGTCTTTATACAATTTCGAATGACATAAAAAAATAA

Protein Analysis

117

Amino Acids

14.16

Weight (kDa)

11.89

Isoelectric Point (pI)

53.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L20 PF00453 3 - 107 6.1e-31 Ribosomal protein L20
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020180)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00660
malus_domestica MD11G1294300.v1.1
pyrus_communis pycom12397g00190
rosa_chinensis RchiOBHm_CPg0502001
rosa_roxburghii Rroxscaffold_2G00119030
rosa_wichuraiana Rw5G040380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 234
AccII CGCG 1 cut(s) 18
AciI CCGC 1 cut(s) 18
AclWI GGATC 1 cut(s) 191
AcsI RAATTY 1 cut(s) 239
AluBI AGCT 4 cut(s) 29, 69, 125, 302
AluI AGCT 4 cut(s) 29, 69, 125, 302
AlwI GGATC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 239
AsuII TTCGAA 1 cut(s) 335
BanII GRGCYC 1 cut(s) 82
BceAI ACGGC 3 cut(s) 104, 159, 185
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 226
BmsI GCATC 1 cut(s) 71
Bpu14I TTCGAA 1 cut(s) 335
Bsh1236I CGCG 1 cut(s) 18
Bsp119I TTCGAA 1 cut(s) 335
Bsp1286I GDGCHC 1 cut(s) 82
Bsp143I GATC 1 cut(s) 183
BspACI CCGC 1 cut(s) 18
BspFNI CGCG 1 cut(s) 18
BspPI GGATC 1 cut(s) 191
BspT104I TTCGAA 1 cut(s) 335
BssMI GATC 1 cut(s) 183
BstBI TTCGAA 1 cut(s) 335
BstFNI CGCG 1 cut(s) 18
BstKTI GATC 1 cut(s) 186
BstMBI GATC 1 cut(s) 183
BstMWI GCNNNNNNNGC 1 cut(s) 299
BstSFI CTRYAG 1 cut(s) 226
BstUI CGCG 1 cut(s) 18
CviJI RGCY 7 cut(s) 29, 69, 80, 91, 125, 137, 302
CviKI_1 RGCY 7 cut(s) 29, 69, 80, 91, 125, 137, 302
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eco24I GRGCYC 1 cut(s) 82
EcoRI GAATTC 1 cut(s) 239
EcoT38I GRGCYC 1 cut(s) 82
FriOI GRGCYC 1 cut(s) 82
FspBI CTAG 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 67
HinfI GANTC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 33, 282
Hpy188III TCNNGA 2 cut(s) 143, 209
HpyCH4V TGCA 2 cut(s) 62, 293
HpyF10VI GCNNNNNNNGC 1 cut(s) 299
Kzo9I GATC 1 cut(s) 183
LweI GCATC 1 cut(s) 71
MaeI CTAG 1 cut(s) 6
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MhlI GDGCHC 1 cut(s) 82
MluCI AATT 5 cut(s) 9, 204, 239, 266, 330
MlyI GAGTC 1 cut(s) 100
MnlI CCTC 2 cut(s) 27, 68
MseI TTAA 3 cut(s) 12, 276, 308
MvnI CGCG 1 cut(s) 18
MwoI GCNNNNNNNGC 1 cut(s) 299
NdeII GATC 1 cut(s) 183
NspV TTCGAA 1 cut(s) 335
PcsI WCGNNNNNNNCGW 1 cut(s) 94
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
PsiI TTATAA 1 cut(s) 234
SaqAI TTAA 3 cut(s) 12, 276, 308
Sau3AI GATC 1 cut(s) 183
SchI GAGTC 1 cut(s) 100
SduI GDGCHC 1 cut(s) 82
SetI ASST 4 cut(s) 31, 71, 127, 304
SfaNI GCATC 1 cut(s) 71
SfcI CTRYAG 1 cut(s) 226
SfuI TTCGAA 1 cut(s) 335
Sse9I AATT 5 cut(s) 9, 204, 239, 266, 330
SsiI CCGC 1 cut(s) 18
SspMI CTAG 1 cut(s) 6
TaqI TCGA 3 cut(s) 73, 190, 335
TasI AATT 5 cut(s) 9, 204, 239, 266, 330
Tru1I TTAA 3 cut(s) 12, 276, 308
Tru9I TTAA 3 cut(s) 12, 276, 308
TspDTI ATGAA 2 cut(s) 232, 252
XapI RAATTY 1 cut(s) 239
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.