MD11G1294300.v1.1

Binds directly to 23S ribosomal RNA and is necessary for the in vitro assembly process of the 50S ribosomal subunit. It is not involved in the protein synthesizing functions of that subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
41326105 .. 41326254
150 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1294300.v1.1.491

Sequence Viewer

Length: 150 bp
ATGACCAGAATTAAACGAGGGTATATAGCTCGAAGACGTAGAACAAAAATTCGTTTATTTGCATCAACCTTTCGAGGGGCTCATTCAAGACTTACTCGTACTATTACTCAACAGAAAATAAGAGCTTTTAGTTTCGGCTCATCGGGATAA

Protein Analysis

50

Amino Acids

5.74

Weight (kDa)

12.0

Isoelectric Point (pI)

49.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L20 PF00453 3 - 45 5.4e-07 Ribosomal protein L20
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020180)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00660
malus_domestica MD11G1294300.v1.1
pyrus_communis pycom12397g00190
rosa_chinensis RchiOBHm_CPg0502001
rosa_roxburghii Rroxscaffold_2G00119030
rosa_wichuraiana Rw5G040380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 48
AfaI GTAC 1 cut(s) 100
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 1 cut(s) 87
AluBI AGCT 2 cut(s) 29, 125
AluI AGCT 2 cut(s) 29, 125
ApoI RAATTY 1 cut(s) 48
BanII GRGCYC 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 40
BmsI GCATC 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 40
Bsc4I CCNNNNNNNGG 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 82
BstV2I GAAGAC 1 cut(s) 40
Csp6I GTAC 1 cut(s) 99
CviJI RGCY 4 cut(s) 29, 80, 125, 138
CviKI_1 RGCY 4 cut(s) 29, 80, 125, 138
CviQI GTAC 1 cut(s) 99
Eco24I GRGCYC 1 cut(s) 82
EcoT38I GRGCYC 1 cut(s) 82
FaiI YATR 2 cut(s) 24, 26
FriOI GRGCYC 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 87, 144
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 62
HpySE526I ACGT 1 cut(s) 37
LpnPI CCDG 1 cut(s) 19
LweI GCATC 1 cut(s) 71
MaeII ACGT 1 cut(s) 37
MboII GAAGA 1 cut(s) 45
MhlI GDGCHC 1 cut(s) 82
MluCI AATT 2 cut(s) 9, 48
MnlI CCTC 2 cut(s) 11, 68
MseI TTAA 1 cut(s) 12
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
SaqAI TTAA 1 cut(s) 12
SduI GDGCHC 1 cut(s) 82
SetI ASST 4 cut(s) 31, 40, 71, 127
SfaNI GCATC 1 cut(s) 71
SgeI CNNG 6 cut(s) 18, 29, 42, 86, 99, 108
Sse9I AATT 2 cut(s) 9, 48
TaiI ACGT 1 cut(s) 40
TaqI TCGA 2 cut(s) 31, 73
TasI AATT 2 cut(s) 9, 48
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
XapI RAATTY 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.