Rroxscaffold_2G00119030

Binds directly to 23S ribosomal RNA and is necessary for the in vitro assembly process of the 50S ribosomal subunit. It is not involved in the protein synthesizing functions of that subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
50830928 .. 50831281
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00119030.1

Sequence Viewer

Length: 354 bp
ATGACCAGAATTAAACGAGGGTATATAGCTCGAAGACGTAGAACAAAAATCCGTTTATTTGCATCAACTTTTCGAGGGGCTCATTCAAGACTTACTCGGACTATTACTCAACAGAAAATAAGAGCTTTGGTTTCGGCTCATCGGGATAGGGGTAGACAAAAGAGAGATTTTCGTCGTTTGTGGATTACTCGTATAAATGCAGTAATTCGAGACAAGAAAGTATACTTTAGTTATAGTAAGTTAATACACAATCTGTACAAGAAACAATTGCTTCTTAATCGTAAAATACTTGCACAAATAGCTATATTAAATAAGAGTTGTCTTTATATGATTTCCAATGAGATCATAAAATAA

Protein Analysis

117

Amino Acids

14.14

Weight (kDa)

11.93

Isoelectric Point (pI)

49.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L20 PF00453 3 - 107 6.8e-31 Ribosomal protein L20
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020180)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00660
malus_domestica MD11G1294300.v1.1
pyrus_communis pycom12397g00190
rosa_chinensis RchiOBHm_CPg0502001
rosa_roxburghii Rroxscaffold_2G00119030
rosa_wichuraiana Rw5G040380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 154, 222
AfaI GTAC 1 cut(s) 257
AgsI TTSAA 1 cut(s) 87
AluBI AGCT 3 cut(s) 29, 125, 302
AluI AGCT 3 cut(s) 29, 125, 302
Alw26I GTCTC 1 cut(s) 204
BanII GRGCYC 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 204
BmsI GCATC 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 204
Bsp1286I GDGCHC 1 cut(s) 82
Bsp1407I TGTACA 1 cut(s) 255
Bsp143I GATC 1 cut(s) 342
BsrGI TGTACA 1 cut(s) 255
BssMI GATC 1 cut(s) 342
BssNAI GTATAC 1 cut(s) 223
Bst1107I GTATAC 1 cut(s) 223
BstAUI TGTACA 1 cut(s) 255
BstKTI GATC 1 cut(s) 345
BstMAI GTCTC 1 cut(s) 204
BstMBI GATC 1 cut(s) 342
BstMWI GCNNNNNNNGC 1 cut(s) 299
BstV2I GAAGAC 1 cut(s) 40
BstZ17I GTATAC 1 cut(s) 223
Csp6I GTAC 1 cut(s) 256
CviJI RGCY 5 cut(s) 29, 80, 125, 137, 302
CviKI_1 RGCY 5 cut(s) 29, 80, 125, 137, 302
CviQI GTAC 1 cut(s) 256
DpnI GATC 1 cut(s) 344
DpnII GATC 1 cut(s) 342
Eco24I GRGCYC 1 cut(s) 82
EcoT38I GRGCYC 1 cut(s) 82
FaiI YATR 9 cut(s) 24, 26, 194, 223, 234, 305, 327, 329, 347
FblI GTMKAC 2 cut(s) 154, 222
FriOI GRGCYC 1 cut(s) 82
Hpy166II GTNNAC 2 cut(s) 155, 223
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 3 cut(s) 87, 143, 209
Hpy8I GTNNAC 2 cut(s) 155, 223
Hpy99I CGWCG 1 cut(s) 177
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 3 cut(s) 62, 200, 293
HpyF10VI GCNNNNNNNGC 1 cut(s) 299
HpySE526I ACGT 1 cut(s) 37
Kzo9I GATC 1 cut(s) 342
LpnPI CCDG 1 cut(s) 19
LweI GCATC 1 cut(s) 71
MaeII ACGT 1 cut(s) 37
MalI GATC 1 cut(s) 344
MboI GATC 1 cut(s) 342
MboII GAAGA 1 cut(s) 45
MfeI CAATTG 1 cut(s) 266
MhlI GDGCHC 1 cut(s) 82
MluCI AATT 3 cut(s) 9, 204, 266
MnlI CCTC 2 cut(s) 11, 68
MseI TTAA 4 cut(s) 12, 242, 276, 308
MunI CAATTG 1 cut(s) 266
MwoI GCNNNNNNNGC 1 cut(s) 299
NdeII GATC 1 cut(s) 342
RsaI GTAC 1 cut(s) 257
RsaNI GTAC 1 cut(s) 256
SaqAI TTAA 4 cut(s) 12, 242, 276, 308
Sau3AI GATC 1 cut(s) 342
SduI GDGCHC 1 cut(s) 82
SetI ASST 4 cut(s) 31, 40, 127, 304
SfaNI GCATC 1 cut(s) 71
Sse9I AATT 3 cut(s) 9, 204, 266
TaiI ACGT 1 cut(s) 40
TaqI TCGA 3 cut(s) 31, 73, 208
TasI AATT 3 cut(s) 9, 204, 266
TatI WGTACW 1 cut(s) 255
Tru1I TTAA 4 cut(s) 12, 242, 276, 308
Tru9I TTAA 4 cut(s) 12, 242, 276, 308
TspGWI ACGGA 1 cut(s) 41
XmiI GTMKAC 2 cut(s) 154, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.