ATCG01270

Chloroplast protein precursor Ycf15 putative

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
Physical Location & Seq
Reverse (-)
144921 .. 145154
234 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG01270.1

Sequence Viewer

Length: 234 bp
ATGCTACTACTGAAACATGGAAGAATTGAAATCTTAGATCAAAACACTATGTATGGATGGTATGAACTGCCTAAACAAGAATTCTTGAACAGCGAACAACCGGAGCTATTACTCACTACATCAAAAAAATTTCCATTAATAAAAGATGGAAATCCATTGGAAAATCAAAAATACGCATGTCGGATTAAATTGTTGTTGCTATCTGTTCCAATAACGAATCAACTGAATAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

9.01

Weight (kDa)

7.86

Isoelectric Point (pI)

42.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf15 PF10705 1 - 51 5.8e-22 Chloroplast protein precursor Ycf15 putative
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019617)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 80, 128
AgsI TTSAA 2 cut(s) 29, 88
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
ApoI RAATTY 2 cut(s) 80, 128
AseI ATTAAT 1 cut(s) 137
BccI CCATC 2 cut(s) 51, 140
BsaBI GATNNNNATC 1 cut(s) 150
BsaWI WCCGGW 1 cut(s) 100
Bse8I GATNNNNATC 1 cut(s) 150
BseGI GGATG 1 cut(s) 62
BseJI GATNNNNATC 1 cut(s) 150
BsiSI CCGG 1 cut(s) 101
Bsp143I GATC 1 cut(s) 37
BssMI GATC 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 34
BstF5I GGATG 1 cut(s) 62
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstNSI RCATGY 1 cut(s) 180
BtsCI GGATG 1 cut(s) 62
CviAII CATG 2 cut(s) 17, 177
CviJI RGCY 1 cut(s) 106
CviKI_1 RGCY 1 cut(s) 106
DdeI CTNAG 1 cut(s) 34
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 80
FaeI CATG 2 cut(s) 20, 180
FaiI YATR 5 cut(s) 18, 50, 54, 63, 178
FatI CATG 2 cut(s) 16, 176
FokI GGATG 1 cut(s) 69
HapII CCGG 1 cut(s) 101
Hin1II CATG 2 cut(s) 20, 180
HinfI GANTC 1 cut(s) 217
HpaII CCGG 1 cut(s) 101
Hpy188I TCNGA 1 cut(s) 183
Hpy188III TCNNGA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 2 cut(s) 20, 180
Kzo9I GATC 1 cut(s) 37
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 1 cut(s) 114
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 33
MluCI AATT 4 cut(s) 24, 80, 128, 188
MmeI TCCRAC 1 cut(s) 161
MseI TTAA 2 cut(s) 137, 186
MspI CCGG 1 cut(s) 101
NdeII GATC 1 cut(s) 37
NlaIII CATG 2 cut(s) 20, 180
NspI RCATGY 1 cut(s) 180
PfeI GAWTC 1 cut(s) 217
PshBI ATTAAT 1 cut(s) 137
SaqAI TTAA 2 cut(s) 137, 186
Sau3AI GATC 1 cut(s) 37
SetI ASST 1 cut(s) 108
SgeI CNNG 5 cut(s) 29, 89, 97, 113, 189
Sse9I AATT 4 cut(s) 24, 80, 128, 188
TasI AATT 4 cut(s) 24, 80, 128, 188
TfiI GAWTC 1 cut(s) 217
Tru1I TTAA 2 cut(s) 137, 186
Tru9I TTAA 2 cut(s) 137, 186
TspDTI ATGAA 1 cut(s) 78
VspI ATTAAT 1 cut(s) 137
XapI RAATTY 2 cut(s) 80, 128
XceI RCATGY 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.