MD17G1255700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
31355255 .. 31355404
150 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1255700.v1.1.491

Sequence Viewer

Length: 150 bp
ATGCATCTTTACCCTTGTCTCAACCTACTAGAGCTTCAGAACTACATCAAAAAATTTCCATTAATGAAAGATGTAAATCCATTGGAAAATAAAAAATACGCATGTCGGATGAAATGGTTGTTGCTATCTGCTACAATAACGACTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.88

Weight (kDa)

9.34

Isoelectric Point (pI)

55.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019617)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 53
AcuI CTGAAG 1 cut(s) 20
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 23
ApoI RAATTY 1 cut(s) 53
AseI ATTAAT 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 23
BfaI CTAG 1 cut(s) 29
BmsI GCATC 1 cut(s) 13
BsaBI GATNNNNATC 1 cut(s) 75
Bse8I GATNNNNATC 1 cut(s) 75
BseGI GGATG 1 cut(s) 114
BseJI GATNNNNATC 1 cut(s) 75
BsmAI GTCTC 1 cut(s) 23
BstF5I GGATG 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 105
BtsCI GGATG 1 cut(s) 114
CviAII CATG 1 cut(s) 102
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
Eco57I CTGAAG 1 cut(s) 20
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 105
FaiI YATR 1 cut(s) 103
FatI CATG 1 cut(s) 101
FokI GGATG 1 cut(s) 121
FspBI CTAG 1 cut(s) 29
FspEI CC 8 cut(s) 26, 27, 38, 68, 72, 91, 93, 100
Hin1II CATG 1 cut(s) 105
HinfI GANTC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 39, 108
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 105
LweI GCATC 1 cut(s) 13
MaeI CTAG 1 cut(s) 29
MluCI AATT 1 cut(s) 53
MlyI GAGTC 1 cut(s) 136
MmeI TCCRAC 1 cut(s) 86
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 62
NlaIII CATG 1 cut(s) 105
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 105
PleI GAGTC 1 cut(s) 136
PpsI GAGTC 1 cut(s) 136
PshBI ATTAAT 1 cut(s) 62
SaqAI TTAA 1 cut(s) 62
SchI GAGTC 1 cut(s) 136
SetI ASST 2 cut(s) 27, 36
SfaNI GCATC 1 cut(s) 13
SgeI CNNG 3 cut(s) 27, 41, 114
Sse9I AATT 1 cut(s) 53
SspMI CTAG 1 cut(s) 29
TasI AATT 1 cut(s) 53
Tru1I TTAA 1 cut(s) 62
Tru9I TTAA 1 cut(s) 62
TspDTI ATGAA 2 cut(s) 80, 125
VspI ATTAAT 1 cut(s) 62
XapI RAATTY 1 cut(s) 53
XceI RCATGY 1 cut(s) 105
XspI CTAG 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.