MD11G1013500.v1.1

Chloroplast protein precursor Ycf15 putative

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0019617
Physical Location & Seq
Reverse (-)
1066252 .. 1066437
186 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1013500.v1.1.491

Sequence Viewer

Length: 186 bp
ATGTATGAATGGTATGAACTTCCTAAACAAGAATTCTTGAACAGCGAACAACCAGAGCTATTACTCACTACATCAAAAAAATTTCCATTAATGAAAGATGTAAATCCATTGGAAAATAAAAAATACGCATGTCGGATGAAATGGTTGTTGCTATCTGCTACAATAACGACTCATTGGTTTAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ycf15

Protein Analysis

62

Amino Acids

7.44

Weight (kDa)

7.86

Isoelectric Point (pI)

50.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf15 PF10705 1 - 41 3.1e-09 Chloroplast protein precursor Ycf15 putative
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019617)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00870 ATCG01270
malus_domestica MD11G1013500.v1.1 MD17G1255700.v1.1
rosa_chinensis RchiOBHm_Chr5g0051131 RchiOBHm_CPg0501791 RchiOBHm_CPg0502621

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 32, 80
AgsI TTSAA 1 cut(s) 40
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
ApoI RAATTY 2 cut(s) 32, 80
AseI ATTAAT 1 cut(s) 89
BsaBI GATNNNNATC 1 cut(s) 102
Bse8I GATNNNNATC 1 cut(s) 102
BseGI GGATG 1 cut(s) 141
BseJI GATNNNNATC 1 cut(s) 102
BstF5I GGATG 1 cut(s) 141
BstNSI RCATGY 1 cut(s) 132
BtsCI GGATG 1 cut(s) 141
CviAII CATG 1 cut(s) 129
CviJI RGCY 1 cut(s) 58
CviKI_1 RGCY 1 cut(s) 58
EcoRI GAATTC 1 cut(s) 32
FaeI CATG 1 cut(s) 132
FaiI YATR 3 cut(s) 6, 15, 130
FatI CATG 1 cut(s) 128
FokI GGATG 1 cut(s) 148
FspEI CC 8 cut(s) 36, 66, 95, 99, 118, 120, 127, 160
Hin1II CATG 1 cut(s) 132
HinfI GANTC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 135
Hpy188III TCNNGA 1 cut(s) 37
Hsp92II CATG 1 cut(s) 132
LpnPI CCDG 1 cut(s) 66
MluCI AATT 2 cut(s) 32, 80
MlyI GAGTC 1 cut(s) 163
MmeI TCCRAC 1 cut(s) 113
MseI TTAA 2 cut(s) 89, 180
NlaIII CATG 1 cut(s) 132
NspI RCATGY 1 cut(s) 132
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
PshBI ATTAAT 1 cut(s) 89
SaqAI TTAA 2 cut(s) 89, 180
SchI GAGTC 1 cut(s) 163
SetI ASST 1 cut(s) 60
SgeI CNNG 4 cut(s) 41, 49, 65, 141
Sse9I AATT 2 cut(s) 32, 80
TasI AATT 2 cut(s) 32, 80
Tru1I TTAA 2 cut(s) 89, 180
Tru9I TTAA 2 cut(s) 89, 180
TspDTI ATGAA 4 cut(s) 21, 30, 107, 152
VspI ATTAAT 1 cut(s) 89
XapI RAATTY 2 cut(s) 32, 80
XceI RCATGY 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.