RchiOBHm_Chr5g0051131

Chloroplast protein precursor Ycf15 putative

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
52047044 .. 52047391
348 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32862

Sequence Viewer

Length: 210 bp
ATGAAAGATGTAAATCCATTGGAAAATCAAAAATACGCATGTTGGATGAAATATTTGTTGCTATCTGCTACAATAACGACTCGTTGCAAAGATATCCGCGGGGCGGTTCGTCCTATTCAGATATTCACGACCAAGAAGTACTGGATTCTCTTTCGGGTAGGCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACGGGCGTCTATTATTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.19

Weight (kDa)

10.15

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf15 PF10705 35 - 69 6.2e-18 Chloroplast protein precursor Ycf15 putative
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019617)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 99
AciI CCGC 3 cut(s) 97, 99, 104
AcyI GRCGYC 1 cut(s) 198
AfaI GTAC 1 cut(s) 140
AfiI CCNNNNNNNGG 1 cut(s) 103
AoxI GGCC 1 cut(s) 160
AspS9I GGNCC 1 cut(s) 161
BmcAI AGTACT 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 161
BsaBI GATNNNNATC 1 cut(s) 12
BsaHI GRCGYC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 146
Bse8I GATNNNNATC 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 97
BseGI GGATG 1 cut(s) 51
BseJI GATNNNNATC 1 cut(s) 12
BseLI CCNNNNNNNGG 1 cut(s) 103
BseNI ACTGG 1 cut(s) 146
Bsh1236I CGCG 1 cut(s) 99
BshFI GGCC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 103
BsmI GAATGC 1 cut(s) 192
BsnI GGCC 1 cut(s) 162
BspACI CCGC 3 cut(s) 97, 99, 104
BspANI GGCC 1 cut(s) 162
BspFNI CGCG 1 cut(s) 99
BsrI ACTGG 1 cut(s) 146
BssECI CCNNGG 1 cut(s) 97
BssNI GRCGYC 1 cut(s) 198
BstACI GRCGYC 1 cut(s) 198
BstDSI CCRYGG 1 cut(s) 97
BstF5I GGATG 1 cut(s) 51
BstFNI CGCG 1 cut(s) 99
BstNSI RCATGY 1 cut(s) 42
BstUI CGCG 1 cut(s) 99
BsuRI GGCC 1 cut(s) 162
BtgI CCRYGG 1 cut(s) 97
BtsCI GGATG 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 161
Cfr42I CCGCGG 1 cut(s) 100
CseI GACGC 1 cut(s) 187
Csp6I GTAC 1 cut(s) 139
CviAII CATG 1 cut(s) 39
CviJI RGCY 2 cut(s) 162, 182
CviKI_1 RGCY 2 cut(s) 162, 182
CviQI GTAC 1 cut(s) 139
Eco32I GATATC 1 cut(s) 94
EcoO109I RGGNCCY 1 cut(s) 161
EcoRV GATATC 1 cut(s) 94
FaeI CATG 1 cut(s) 42
FaiI YATR 1 cut(s) 40
FatI CATG 1 cut(s) 38
FauI CCCGC 1 cut(s) 92
FokI GGATG 1 cut(s) 58
HaeIII GGCC 1 cut(s) 162
HgaI GACGC 1 cut(s) 187
Hin1I GRCGYC 1 cut(s) 198
Hin1II CATG 1 cut(s) 42
HinfI GANTC 2 cut(s) 79, 145
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 168, 172
HpyCH4V TGCA 1 cut(s) 87
Hsp92I GRCGYC 1 cut(s) 198
Hsp92II CATG 1 cut(s) 42
KspI CCGCGG 1 cut(s) 100
LpnPI CCDG 3 cut(s) 127, 168, 177
MlyI GAGTC 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 23
MspA1I CMGCKG 1 cut(s) 99
Mva1269I GAATGC 1 cut(s) 192
MvnI CGCG 1 cut(s) 99
NlaIII CATG 1 cut(s) 42
NspI RCATGY 1 cut(s) 42
PctI GAATGC 1 cut(s) 192
PfeI GAWTC 1 cut(s) 145
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PspPI GGNCC 1 cut(s) 161
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
SacII CCGCGG 1 cut(s) 100
Sau96I GGNCC 1 cut(s) 161
ScaI AGTACT 1 cut(s) 140
SchI GAGTC 1 cut(s) 73
Sfr303I CCGCGG 1 cut(s) 100
SgrBI CCGCGG 1 cut(s) 100
SsiI CCGC 3 cut(s) 97, 99, 104
SspI AATATT 1 cut(s) 53
TatI WGTACW 1 cut(s) 138
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 2 cut(s) 17, 62
XceI RCATGY 1 cut(s) 42
ZrmI AGTACT 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.