RCHIOBHM_CPG0501791

Chloroplast protein precursor Ycf15 putative

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
OG0019617
Physical Location & Seq
Reverse (-)
17346 .. 18003
658 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15674

Sequence Viewer

Length: 294 bp
ATGAAAGATGTAAATCCATTGGAAAATCAAAAATACGCATGTTGGATGAAATGGTTGTTGCTATCTGCTACAATAACGACTCGTCGACGGATCTTCTCAATTGAAAGACCCCCTATATGGATAATACACATTCCAGTTGACCGACTAATTCAAATTGTTTTGTTCCGAAGCAAAGATATCCGCGGGGCGGTTCGTCCTATTCAGATATTCACGACCAAGAAGTACTGGATTCTCTTTCGGGTAGGCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACGGGCGTCTATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ycf15

Protein Analysis

97

Amino Acids

11.67

Weight (kDa)

10.98

Isoelectric Point (pI)

69.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf15 PF10705 62 - 97 1.2e-17 Chloroplast protein precursor Ycf15 putative
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019617)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00870 ATCG01270
malus_domestica MD11G1013500.v1.1 MD17G1255700.v1.1
rosa_chinensis RchiOBHm_Chr5g0051131 RchiOBHm_CPg0501791 RchiOBHm_CPg0502621

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 85
AccII CGCG 1 cut(s) 183
AciI CCGC 3 cut(s) 181, 183, 188
AclWI GGATC 1 cut(s) 98
AcyI GRCGYC 1 cut(s) 282
AfaI GTAC 1 cut(s) 224
AfiI CCNNNNNNNGG 2 cut(s) 117, 187
AgsI TTSAA 2 cut(s) 104, 152
AlwI GGATC 1 cut(s) 98
AoxI GGCC 1 cut(s) 244
AspS9I GGNCC 1 cut(s) 245
BmcAI AGTACT 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 245
BsaBI GATNNNNATC 1 cut(s) 12
BsaHI GRCGYC 1 cut(s) 282
BsaJI CCNNGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 2 cut(s) 117, 187
Bse1I ACTGG 2 cut(s) 134, 230
Bse8I GATNNNNATC 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 1 cut(s) 51
BseJI GATNNNNATC 1 cut(s) 12
BseLI CCNNNNNNNGG 2 cut(s) 117, 187
BseNI ACTGG 2 cut(s) 134, 230
Bsh1236I CGCG 1 cut(s) 183
BshFI GGCC 1 cut(s) 246
BslI CCNNNNNNNGG 2 cut(s) 117, 187
BsmI GAATGC 1 cut(s) 276
BsnI GGCC 1 cut(s) 246
Bsp143I GATC 1 cut(s) 90
BspACI CCGC 3 cut(s) 181, 183, 188
BspANI GGCC 1 cut(s) 246
BspFNI CGCG 1 cut(s) 183
BspPI GGATC 1 cut(s) 98
BsrI ACTGG 2 cut(s) 134, 230
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 1 cut(s) 90
BssNI GRCGYC 1 cut(s) 282
BstACI GRCGYC 1 cut(s) 282
BstDSI CCRYGG 1 cut(s) 181
BstF5I GGATG 1 cut(s) 51
BstFNI CGCG 1 cut(s) 183
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 42
BstUI CGCG 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
BsuRI GGCC 1 cut(s) 246
BtgI CCRYGG 1 cut(s) 181
BtsCI GGATG 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 245
Cfr42I CCGCGG 1 cut(s) 184
CseI GACGC 1 cut(s) 271
Csp6I GTAC 1 cut(s) 223
CviAII CATG 1 cut(s) 39
CviJI RGCY 2 cut(s) 246, 266
CviKI_1 RGCY 2 cut(s) 246, 266
CviQI GTAC 1 cut(s) 223
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
Eco32I GATATC 1 cut(s) 178
EcoO109I RGGNCCY 1 cut(s) 245
EcoRV GATATC 1 cut(s) 178
FaeI CATG 1 cut(s) 42
FaiI YATR 3 cut(s) 40, 116, 118
FatI CATG 1 cut(s) 38
FauI CCCGC 1 cut(s) 176
FblI GTMKAC 1 cut(s) 85
FokI GGATG 1 cut(s) 58
HaeIII GGCC 1 cut(s) 246
HgaI GACGC 1 cut(s) 271
Hin1I GRCGYC 1 cut(s) 282
Hin1II CATG 1 cut(s) 42
HincII GTYRAC 2 cut(s) 86, 139
HindII GTYRAC 2 cut(s) 86, 139
HinfI GANTC 2 cut(s) 79, 229
Hpy166II GTNNAC 2 cut(s) 86, 139
Hpy188I TCNGA 2 cut(s) 167, 204
Hpy188III TCNNGA 1 cut(s) 211
Hpy8I GTNNAC 2 cut(s) 86, 139
Hpy99I CGWCG 2 cut(s) 87, 90
HpyAV CCTTC 2 cut(s) 252, 256
Hsp92I GRCGYC 1 cut(s) 282
Hsp92II CATG 1 cut(s) 42
KspI CCGCGG 1 cut(s) 184
Kzo9I GATC 1 cut(s) 90
LpnPI CCDG 4 cut(s) 147, 211, 252, 261
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 1 cut(s) 85
MfeI CAATTG 1 cut(s) 99
MflI RGATCY 1 cut(s) 90
MluCI AATT 3 cut(s) 99, 147, 153
MlyI GAGTC 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 23
MspA1I CMGCKG 1 cut(s) 183
MunI CAATTG 1 cut(s) 99
Mva1269I GAATGC 1 cut(s) 276
MvnI CGCG 1 cut(s) 183
NdeII GATC 1 cut(s) 90
NlaIII CATG 1 cut(s) 42
NspI RCATGY 1 cut(s) 42
PctI GAATGC 1 cut(s) 276
PfeI GAWTC 1 cut(s) 229
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PspPI GGNCC 1 cut(s) 245
PsuI RGATCY 1 cut(s) 90
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
SacII CCGCGG 1 cut(s) 184
SalI GTCGAC 1 cut(s) 84
Sau3AI GATC 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 245
ScaI AGTACT 1 cut(s) 224
SchI GAGTC 1 cut(s) 73
Sfr303I CCGCGG 1 cut(s) 184
SgrBI CCGCGG 1 cut(s) 184
SgrDI CGTCGACG 1 cut(s) 84
Sse9I AATT 3 cut(s) 99, 147, 153
SsiI CCGC 3 cut(s) 181, 183, 188
TaqI TCGA 1 cut(s) 85
TaqII GACCGA 1 cut(s) 156
TasI AATT 3 cut(s) 99, 147, 153
TatI WGTACW 1 cut(s) 222
TfiI GAWTC 1 cut(s) 229
TspDTI ATGAA 2 cut(s) 17, 62
TspGWI ACGGA 1 cut(s) 103
XceI RCATGY 1 cut(s) 42
XmiI GTMKAC 1 cut(s) 85
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.