FvH4_1g07380

isoform X1

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
3912861 .. 3915048
2188 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g07380.t1

Sequence Viewer

Length: 252 bp
ATGGCGGAGCCACCAAATGAAAACCACATCAGGCGCTTCAAGTTCCTGTGGCGAGTCCTCATGATCTCCAATCTCGCTCTCGGAGGTTACATGTTTATTGGGGCTAAGAAGAGAGACACAGGATTCATGAATAAGAAGAAAGCCAAGGAAATTGGCATTAAAAAGCACAAAGCTGTAGTTGATGAAGTGCCCTCTTCTCCTCCAGCTCCTCCTCCCACAACTACTACAAGTTCGGAGACATGGGATTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.35

Weight (kDa)

9.92

Isoelectric Point (pI)

65.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AflIII ACRYGT 1 cut(s) 90
AgsI TTSAA 1 cut(s) 40
AluBI AGCT 2 cut(s) 173, 206
AluI AGCT 2 cut(s) 173, 206
Alw26I GTCTC 2 cut(s) 108, 230
ArsI GACNNNNNNTTYG 1 cut(s) 229
AspLEI GCGC 1 cut(s) 36
BaeGI GKGCMC 1 cut(s) 192
BcoDI GTCTC 2 cut(s) 108, 230
BfmI CTRYAG 1 cut(s) 174
BfoI RGCGCY 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 9
BpmI CTGGAG 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 144
BseRI GAGGAG 3 cut(s) 189, 198, 201
BseSI GKGCMC 1 cut(s) 192
BsmAI GTCTC 2 cut(s) 108, 230
Bsp1286I GDGCHC 1 cut(s) 192
Bsp143I GATC 1 cut(s) 63
BspACI CCGC 1 cut(s) 5
BspHI TCATGA 2 cut(s) 60, 126
BspLI GGNNCC 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 1 cut(s) 63
BssT1I CCWWGG 1 cut(s) 144
Bst6I CTCTTC 2 cut(s) 104, 199
BstDEI CTNAG 1 cut(s) 105
BstH2I RGCGCY 1 cut(s) 37
BstHHI GCGC 1 cut(s) 36
BstKTI GATC 1 cut(s) 66
BstMAI GTCTC 2 cut(s) 108, 230
BstMBI GATC 1 cut(s) 63
BstNSI RCATGY 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 174
BstSLI GKGCMC 1 cut(s) 192
CciI TCATGA 2 cut(s) 60, 126
CfoI GCGC 1 cut(s) 36
CviAII CATG 4 cut(s) 61, 91, 127, 240
CviJI RGCY 5 cut(s) 10, 104, 143, 173, 206
CviKI_1 RGCY 5 cut(s) 10, 104, 143, 173, 206
DdeI CTNAG 1 cut(s) 105
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eam1104I CTCTTC 2 cut(s) 104, 199
EarI CTCTTC 2 cut(s) 104, 199
EciI GGCGGA 1 cut(s) 20
Eco130I CCWWGG 1 cut(s) 144
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 4 cut(s) 64, 94, 130, 243
FaiI YATR 4 cut(s) 62, 92, 128, 241
FatI CATG 4 cut(s) 60, 90, 126, 239
GlaI GCGC 1 cut(s) 35
GsuI CTGGAG 1 cut(s) 186
HaeII RGCGCY 1 cut(s) 37
HhaI GCGC 1 cut(s) 36
Hin1II CATG 4 cut(s) 64, 94, 130, 243
Hin6I GCGC 1 cut(s) 34
HinP1I GCGC 1 cut(s) 34
HinfI GANTC 2 cut(s) 54, 123
Hpy188I TCNGA 2 cut(s) 83, 235
Hpy188III TCNNGA 2 cut(s) 61, 127
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 4 cut(s) 64, 94, 130, 243
HspAI GCGC 1 cut(s) 34
Kzo9I GATC 1 cut(s) 63
LmnI GCTCC 2 cut(s) 7, 211
LpnPI CCDG 4 cut(s) 16, 59, 105, 216
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 3 cut(s) 121, 148, 186
MhlI GDGCHC 1 cut(s) 192
MluCI AATT 1 cut(s) 150
MlyI GAGTC 1 cut(s) 63
MnlI CCTC 6 cut(s) 68, 77, 202, 210, 219, 222
MseI TTAA 1 cut(s) 159
NdeII GATC 1 cut(s) 63
NlaIII CATG 4 cut(s) 64, 94, 130, 243
NlaIV GGNNCC 1 cut(s) 9
NspI RCATGY 1 cut(s) 94
PagI TCATGA 2 cut(s) 60, 126
PciI ACATGT 1 cut(s) 90
PfeI GAWTC 1 cut(s) 123
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
PscI ACATGT 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 9
SaqAI TTAA 1 cut(s) 159
Sau3AI GATC 1 cut(s) 63
SchI GAGTC 1 cut(s) 63
SduI GDGCHC 1 cut(s) 192
SetI ASST 3 cut(s) 88, 175, 208
SfcI CTRYAG 1 cut(s) 174
Sse9I AATT 1 cut(s) 150
SsiI CCGC 1 cut(s) 5
StyI CCWWGG 1 cut(s) 144
TasI AATT 1 cut(s) 150
TfiI GAWTC 1 cut(s) 123
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TspDTI ATGAA 4 cut(s) 33, 115, 143, 198
XceI RCATGY 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.