Prupe.7G210200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
19245732 .. 19247368
1637 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G210200.1

Sequence Viewer

Length: 186 bp
ATGGCGGACCCACCACCACCACCATTACCGCCAAAGGAATTGCCAATCAATCGCTACAAGTTCATTTGGCGAGTCCTCTTGATCTCCAATCTTGCTCTCGGAGGAAGGATTAGTCCCCTCCCTACCCTGATAATGAGAGGCTACTGCCATCTGGACAAACCCACTTCCCATTCCTCTTTACCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.83

Weight (kDa)

9.86

Isoelectric Point (pI)

48.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 29
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BccI CCATC 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 9
BslFI GGGAC 1 cut(s) 99
BsmFI GGGAC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 81
BspACI CCGC 2 cut(s) 5, 29
BspLI GGNNCC 1 cut(s) 9
BssMI GATC 1 cut(s) 81
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
Cfr13I GGNCC 1 cut(s) 7
CviJI RGCY 1 cut(s) 141
CviKI_1 RGCY 1 cut(s) 141
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
EciI GGCGGA 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 7
FaqI GGGAC 1 cut(s) 99
HinfI GANTC 1 cut(s) 72
Hpy188I TCNGA 1 cut(s) 101
Hpy188III TCNNGA 2 cut(s) 79, 152
HpyAV CCTTC 1 cut(s) 99
Kzo9I GATC 1 cut(s) 81
LpnPI CCDG 2 cut(s) 137, 140
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MluCI AATT 1 cut(s) 38
MlyI GAGTC 1 cut(s) 81
MnlI CCTC 5 cut(s) 86, 95, 128, 131, 184
NdeII GATC 1 cut(s) 81
NlaIV GGNNCC 1 cut(s) 9
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 9
PspPI GGNCC 1 cut(s) 7
Sau3AI GATC 1 cut(s) 81
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 1 cut(s) 81
SetI ASST 1 cut(s) 184
SgeI CNNG 7 cut(s) 70, 83, 91, 104, 110, 139, 164
SinI GGWCC 1 cut(s) 7
Sse9I AATT 1 cut(s) 38
SsiI CCGC 2 cut(s) 5, 29
TasI AATT 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.