FvH4_2g10341

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
9236422 .. 9236740
319 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g10341.t1

Sequence Viewer

Length: 216 bp
ATGGAGACCCTTATCAGGGTTGTTGTGTGCTCCTCATTCCCAGCAACTCCTCCAATCCCTCCTCGCTCACTTACCACTAGAAACCCATCTGTCTCGGCCCTCATAACAACTCCATCTCCTGTGAGTGAGGTTGCAGAGGAGGACGTGCTGCAGACATTCTTTAAGGAAAGAAAGTCGAATGGAGACTTCGTTTCAAGACTTTCTGATGTTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.8

Weight (kDa)

5.18

Isoelectric Point (pI)

57.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019200)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10341
rosa_laevigata RLG00000034518
rosa_multiflora Rmu_sc0004955.1_g000005
rosa_samantha Rh5BG315600 Rh5BG328400 Rh5CG341900 Rh5DG325600 Rh5DG339500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 15, 16
AgsI TTSAA 1 cut(s) 195
AjiI CACGTC 1 cut(s) 145
Alw21I GWGCWC 1 cut(s) 32
Alw26I GTCTC 2 cut(s) 97, 177
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 97
Bbv12I GWGCWC 1 cut(s) 32
BbvI GCAGC 1 cut(s) 135
BccI CCATC 2 cut(s) 94, 121
BcoDI GTCTC 2 cut(s) 97, 177
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 149
BisI GCNGC 1 cut(s) 149
BlsI GCNGC 1 cut(s) 150
BmgBI CACGTC 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 97
BsaXI ACNNNNNCTCC 4 cut(s) 100, 130, 174, 204
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 16
BseLI CCNNNNNNNGG 2 cut(s) 15, 16
BseRI GAGGAG 4 cut(s) 22, 39, 51, 152
BseXI GCAGC 1 cut(s) 135
BseYI CCCAGC 1 cut(s) 40
BshFI GGCC 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 32
BslI CCNNNNNNNGG 2 cut(s) 15, 16
BsmAI GTCTC 2 cut(s) 97, 177
BsnI GGCC 1 cut(s) 98
Bsp1286I GDGCHC 1 cut(s) 32
BspANI GGCC 1 cut(s) 98
BspMAI CTGCAG 1 cut(s) 153
BstMAI GTCTC 2 cut(s) 97, 177
BstSFI CTRYAG 1 cut(s) 149
BstV1I GCAGC 1 cut(s) 135
BsuRI GGCC 1 cut(s) 98
BtrI CACGTC 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 97
CviJI RGCY 1 cut(s) 98
CviKI_1 RGCY 1 cut(s) 98
FaiI YATR 1 cut(s) 104
Fnu4HI GCNGC 1 cut(s) 149
Fsp4HI GCNGC 1 cut(s) 149
FspBI CTAG 1 cut(s) 78
GluI GCNGC 1 cut(s) 149
GsaI CCCAGC 1 cut(s) 44
HaeIII GGCC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 195
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 2 cut(s) 134, 151
HpySE526I ACGT 1 cut(s) 144
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 2 cut(s) 54, 132
Lsp1109I GCAGC 1 cut(s) 135
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 144
MhlI GDGCHC 1 cut(s) 32
MnlI CCTC 8 cut(s) 43, 60, 69, 72, 110, 121, 130, 133
MseI TTAA 1 cut(s) 162
NmeAIII GCCGAG 1 cut(s) 74
PkrI GCNGC 1 cut(s) 150
PspFI CCCAGC 1 cut(s) 40
PspPI GGNCC 1 cut(s) 97
PstI CTGCAG 1 cut(s) 153
SaqAI TTAA 1 cut(s) 162
SatI GCNGC 1 cut(s) 149
Sau96I GGNCC 1 cut(s) 97
SduI GDGCHC 1 cut(s) 32
SetI ASST 2 cut(s) 132, 147
SfcI CTRYAG 1 cut(s) 149
SgeI CNNG 8 cut(s) 28, 53, 75, 90, 106, 131, 157, 207
SspMI CTAG 1 cut(s) 78
TaiI ACGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 176
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseI GCWGC 1 cut(s) 148
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.