Rmu_sc0004955.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004955.1
Physical Location & Seq
Forward (+)
24937 .. 25347
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004955.1_g000005.1.cds

Sequence Viewer

Length: 312 bp
atggagacccttttcagggttgtgtgctcctcattccctgcaagtcctccaatccctcatcgctcactttccactagaaacccatctgtctcagtcctcaaaacaggcccatctcctgtgagtgagcttgcaaaagaggacgtgctgcagacgttcttcaaggaaagacagttgaatggagacttcatatcaagactttctgacgtgttttggcagagggagtttacgaattttgttgatggtgatggtgttggtgacattgatgacacaattactcaacaacaagcagaagagcaggtacatgacctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.58

Weight (kDa)

4.58

Isoelectric Point (pI)

43.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019200)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10341
rosa_laevigata RLG00000034518
rosa_multiflora Rmu_sc0004955.1_g000005
rosa_samantha Rh5BG315600 Rh5BG328400 Rh5CG341900 Rh5DG325600 Rh5DG339500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 286
AcsI RAATTY 1 cut(s) 229
AfaI GTAC 1 cut(s) 300
AfiI CCNNNNNNNGG 2 cut(s) 15, 16
AflIII ACRYGT 1 cut(s) 204
AgsI TTSAA 2 cut(s) 160, 175
AjiI CACGTC 2 cut(s) 142, 205
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw21I GWGCWC 1 cut(s) 29
Alw26I GTCTC 2 cut(s) 94, 174
AoxI GGCC 1 cut(s) 106
ApeKI GCWGC 1 cut(s) 145
ApoI RAATTY 1 cut(s) 229
AspS9I GGNCC 1 cut(s) 107
AsuHPI GGTGA 2 cut(s) 254, 266
BarI GAAGNNNNNNTAC 1 cut(s) 282
Bbv12I GWGCWC 1 cut(s) 29
BbvI GCAGC 1 cut(s) 132
BccI CCATC 4 cut(s) 91, 118, 233, 239
BcoDI GTCTC 2 cut(s) 94, 174
BfaI CTAG 1 cut(s) 75
BfmI CTRYAG 1 cut(s) 146
BfuAI ACCTGC 1 cut(s) 286
BisI GCNGC 1 cut(s) 146
BlsI GCNGC 1 cut(s) 147
BmgBI CACGTC 2 cut(s) 142, 205
BmgT120I GGNCC 1 cut(s) 107
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 16
BseLI CCNNNNNNNGG 2 cut(s) 15, 16
BseMII CTCAG 1 cut(s) 105
BseRI GAGGAG 1 cut(s) 19
BseXI GCAGC 1 cut(s) 132
BshFI GGCC 1 cut(s) 108
BsiHKAI GWGCWC 1 cut(s) 29
BslI CCNNNNNNNGG 2 cut(s) 15, 16
BsmAI GTCTC 2 cut(s) 94, 174
BsnI GGCC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 29
BspANI GGCC 1 cut(s) 108
BspCNI CTCAG 1 cut(s) 104
BspMAI CTGCAG 1 cut(s) 150
BspMI ACCTGC 1 cut(s) 286
BspQI GCTCTTC 1 cut(s) 285
Bst4CI ACNGT 1 cut(s) 171
Bst6I CTCTTC 1 cut(s) 285
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 91
BstMAI GTCTC 2 cut(s) 94, 174
BstSFI CTRYAG 1 cut(s) 146
BstV1I GCAGC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 108
BtgZI GCGATG 1 cut(s) 44
BtrI CACGTC 2 cut(s) 142, 205
BveI ACCTGC 1 cut(s) 286
Cac8I GCNNGC 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 299
CviAII CATG 1 cut(s) 302
CviJI RGCY 2 cut(s) 108, 127
CviKI_1 RGCY 2 cut(s) 108, 127
CviQI GTAC 1 cut(s) 299
DdeI CTNAG 1 cut(s) 91
Eam1104I CTCTTC 1 cut(s) 285
EarI CTCTTC 1 cut(s) 285
FaeI CATG 1 cut(s) 305
FaiI YATR 2 cut(s) 188, 303
FatI CATG 1 cut(s) 301
Fnu4HI GCNGC 1 cut(s) 146
Fsp4HI GCNGC 1 cut(s) 146
FspBI CTAG 1 cut(s) 75
GluI GCNGC 1 cut(s) 146
HaeIII GGCC 1 cut(s) 108
Hin1II CATG 1 cut(s) 305
HphI GGTGA 2 cut(s) 254, 266
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 192
Hpy8I GTNNAC 1 cut(s) 225
HpyCH4III ACNGT 1 cut(s) 171
HpyCH4IV ACGT 3 cut(s) 141, 152, 204
HpyCH4V TGCA 3 cut(s) 41, 131, 148
HpyF3I CTNAG 1 cut(s) 91
HpySE526I ACGT 3 cut(s) 141, 152, 204
Hsp92II CATG 1 cut(s) 305
LguI GCTCTTC 1 cut(s) 285
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 4 cut(s) 51, 90, 129, 281
Lsp1109I GCAGC 1 cut(s) 132
MaeI CTAG 1 cut(s) 75
MaeII ACGT 3 cut(s) 141, 152, 204
MaeIII GTNAC 1 cut(s) 254
MboII GAAGA 2 cut(s) 148, 302
MhlI GDGCHC 1 cut(s) 29
MluCI AATT 2 cut(s) 229, 270
MnlI CCTC 6 cut(s) 40, 57, 66, 107, 130, 210
NlaIII CATG 1 cut(s) 305
NmuCI GTSAC 1 cut(s) 254
PciSI GCTCTTC 1 cut(s) 285
PkrI GCNGC 1 cut(s) 147
PspPI GGNCC 1 cut(s) 107
PstI CTGCAG 1 cut(s) 150
RsaI GTAC 1 cut(s) 300
RsaNI GTAC 1 cut(s) 299
SapI GCTCTTC 1 cut(s) 285
SatI GCNGC 1 cut(s) 146
Sau96I GGNCC 1 cut(s) 107
SduI GDGCHC 1 cut(s) 29
SetI ASST 6 cut(s) 129, 144, 155, 207, 300, 309
SfcI CTRYAG 1 cut(s) 146
Sse9I AATT 2 cut(s) 229, 270
SspMI CTAG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 171
TaiI ACGT 3 cut(s) 144, 155, 207
TasI AATT 2 cut(s) 229, 270
TseFI GTSAC 1 cut(s) 254
TseI GCWGC 1 cut(s) 145
Tsp45I GTSAC 1 cut(s) 254
TspDTI ATGAA 1 cut(s) 175
XapI RAATTY 1 cut(s) 229
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.