Rh5CG341900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
39163119 .. 39170915
7797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG341900.1

Sequence Viewer

Length: 351 bp
ATGAAGACCCTTTTCAGGGTTGTGTGCTCCTCATTCCCAGCAACTCCTCCAATCCCTCATCGCTCACTTTCCACTAGAAACCCATCTATCTCGGCCCTCAGAACCGGCCCATCTCCTGTGAGTGAGCTTGCAGAAGAGAACGTGCTCCAGACGTTCTTCAAGGAAAGACAGTTGAATGGAGACTTCATATCAAGACTTTCTGACGTGTTTTGGCAGAGGGAGTTTACGAATTTTGTTGATGGTGATGGTGTTGGCAACATTGATGACACTACTACTCAACAACAAGCAGAAAAGCAGTTTTGTGTTCATCAGGAAATCATGGCTTTGGAAGTTGTGGGCAAAACTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.02

Weight (kDa)

5.29

Isoelectric Point (pI)

42.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019200)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10341
rosa_laevigata RLG00000034518
rosa_multiflora Rmu_sc0004955.1_g000005
rosa_samantha Rh5BG315600 Rh5BG328400 Rh5CG341900 Rh5DG325600 Rh5DG339500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 229
AfiI CCNNNNNNNGG 2 cut(s) 15, 16
AflIII ACRYGT 1 cut(s) 204
AgsI TTSAA 2 cut(s) 160, 175
AjiI CACGTC 1 cut(s) 205
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw21I GWGCWC 2 cut(s) 29, 147
Alw26I GTCTC 1 cut(s) 174
AoxI GGCC 2 cut(s) 93, 106
ApoI RAATTY 1 cut(s) 229
AspS9I GGNCC 2 cut(s) 94, 107
AsuHPI GGTGA 1 cut(s) 254
BbsI GAAGAC 1 cut(s) 11
Bbv12I GWGCWC 2 cut(s) 29, 147
BccI CCATC 4 cut(s) 91, 118, 233, 239
BcoDI GTCTC 1 cut(s) 174
BfaI CTAG 1 cut(s) 75
BmgBI CACGTC 1 cut(s) 205
BmgT120I GGNCC 2 cut(s) 94, 107
BpiI GAAGAC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 131
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 16
Bse118I RCCGGY 1 cut(s) 104
BseLI CCNNNNNNNGG 2 cut(s) 15, 16
BseMII CTCAG 1 cut(s) 112
BseRI GAGGAG 2 cut(s) 19, 36
BseYI CCCAGC 1 cut(s) 37
BshFI GGCC 2 cut(s) 95, 108
BsiHKAI GWGCWC 2 cut(s) 29, 147
BsiSI CCGG 1 cut(s) 105
BslI CCNNNNNNNGG 2 cut(s) 15, 16
BsmAI GTCTC 1 cut(s) 174
BsnI GGCC 2 cut(s) 95, 108
Bsp1286I GDGCHC 2 cut(s) 29, 147
BspANI GGCC 2 cut(s) 95, 108
BspCNI CTCAG 1 cut(s) 111
BsrFI RCCGGY 1 cut(s) 104
BssAI RCCGGY 1 cut(s) 104
Bst4CI ACNGT 2 cut(s) 171, 346
Bst6I CTCTTC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 98
BstMAI GTCTC 1 cut(s) 174
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 2 cut(s) 95, 108
BtgZI GCGATG 1 cut(s) 44
BtrI CACGTC 1 cut(s) 205
Cac8I GCNNGC 1 cut(s) 129
Cfr10I RCCGGY 1 cut(s) 104
Cfr13I GGNCC 2 cut(s) 94, 107
CviAII CATG 1 cut(s) 319
CviJI RGCY 4 cut(s) 95, 108, 127, 323
CviKI_1 RGCY 4 cut(s) 95, 108, 127, 323
DdeI CTNAG 1 cut(s) 98
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
FaeI CATG 1 cut(s) 322
FaiI YATR 2 cut(s) 188, 320
FatI CATG 1 cut(s) 318
FspBI CTAG 1 cut(s) 75
GsaI CCCAGC 1 cut(s) 41
GsuI CTGGAG 1 cut(s) 131
HaeIII GGCC 2 cut(s) 95, 108
HapII CCGG 1 cut(s) 105
Hin1II CATG 1 cut(s) 322
HpaII CCGG 1 cut(s) 105
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 2 cut(s) 101, 202
Hpy188III TCNNGA 3 cut(s) 148, 192, 311
Hpy8I GTNNAC 1 cut(s) 225
HpyCH4III ACNGT 2 cut(s) 171, 346
HpyCH4IV ACGT 3 cut(s) 141, 152, 204
HpyCH4V TGCA 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 98
HpySE526I ACGT 3 cut(s) 141, 152, 204
Hsp92II CATG 1 cut(s) 322
LmnI GCTCC 2 cut(s) 32, 150
LpnPI CCDG 5 cut(s) 51, 118, 129, 161, 296
MaeI CTAG 1 cut(s) 75
MaeII ACGT 3 cut(s) 141, 152, 204
MboII GAAGA 3 cut(s) 16, 146, 148
MhlI GDGCHC 2 cut(s) 29, 147
MluCI AATT 1 cut(s) 229
MnlI CCTC 5 cut(s) 40, 57, 66, 107, 210
MspI CCGG 1 cut(s) 105
NlaIII CATG 1 cut(s) 322
NmeAIII GCCGAG 1 cut(s) 71
PspFI CCCAGC 1 cut(s) 37
PspPI GGNCC 2 cut(s) 94, 107
Sau96I GGNCC 2 cut(s) 94, 107
SduI GDGCHC 2 cut(s) 29, 147
SetI ASST 4 cut(s) 129, 144, 155, 207
Sse9I AATT 1 cut(s) 229
SspMI CTAG 1 cut(s) 75
TaaI ACNGT 2 cut(s) 171, 346
TaiI ACGT 3 cut(s) 144, 155, 207
TasI AATT 1 cut(s) 229
TspDTI ATGAA 3 cut(s) 17, 175, 296
XapI RAATTY 1 cut(s) 229
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.