FvH4_2g14011

HEAT repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0018795
Physical Location & Seq
Forward (+)
12330875 .. 12331647
773 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g14011.t1

Sequence Viewer

Length: 333 bp
ATGGCCCGACCTAGCCGGGCCAGGCTTTTTAACTGGCCCTTTTTAGAGTATATCTTGGTCGCGCAATCGGAGTCTCTCGTCGCCTCCGCCACCCAGGAGCCACCGGAGACCCTCCTCTGCTTCAATCTCCTCTCTGGTCTCACATCTGCTTCGATCTCCTCTCCTGTCTCATCTCTGCTTCGATCTCTTCTCTGGTCTCACCTCTGCTTCGATCTCCTCTCCGATCTCATCTCTGCTTTGAATCCTTGTAGCCCAGTCATTGCAAGAATGGAAAGCCTAGAGAAACCGGCCAGATGTTGCCGGTCCGAGTTTAAGCCATCCCTGAGATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.17

Weight (kDa)

7.63

Isoelectric Point (pI)

69.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018795)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g14011
rosa_chinensis RchiOBHm_Chr1g0354611 RchiOBHm_Chr2g0131331 RchiOBHm_Chr5g0010141
rosa_laevigata RLG00000028196
rosa_multiflora Rmu_sc0036491.1_g000001
rosa_samantha Rh1AG254500 Rh1CG237600 Rh7CG466400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 62
AciI CCGC 1 cut(s) 87
AcoI YGGCCR 1 cut(s) 288
AgsI TTSAA 2 cut(s) 124, 241
AjnI CCWGG 2 cut(s) 20, 93
Alw26I GTCTC 5 cut(s) 78, 101, 143, 172, 201
AoxI GGCC 4 cut(s) 3, 18, 35, 288
AspLEI GCGC 1 cut(s) 64
AspS9I GGNCC 4 cut(s) 4, 18, 36, 303
AsuC2I CCSGG 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 1 cut(s) 303
BccI CCATC 1 cut(s) 325
BciT130I CCWGG 2 cut(s) 22, 95
BcnI CCSGG 1 cut(s) 17
BcoDI GTCTC 5 cut(s) 78, 101, 143, 172, 201
BfaI CTAG 2 cut(s) 12, 278
Bme1390I CCNGG 3 cut(s) 17, 22, 95
Bme18I GGWCC 1 cut(s) 303
BmgT120I GGNCC 4 cut(s) 4, 18, 36, 303
BmiI GGNNCC 1 cut(s) 99
BmrFI CCNGG 3 cut(s) 17, 22, 95
BmrI ACTGGG 1 cut(s) 248
BmuI ACTGGG 1 cut(s) 248
BpuMI CCSGG 1 cut(s) 17
BsaI GGTCTC 3 cut(s) 101, 143, 201
BsaJI CCNNGG 1 cut(s) 93
BsaWI WCCGGW 1 cut(s) 103
Bse118I RCCGGY 2 cut(s) 286, 300
Bse1I ACTGG 2 cut(s) 38, 254
Bse3DI GCAATG 1 cut(s) 258
BseBI CCWGG 2 cut(s) 22, 95
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 317
BseMI GCAATG 1 cut(s) 258
BseMII CTCAG 1 cut(s) 314
BseNI ACTGG 2 cut(s) 38, 254
BseRI GAGGAG 4 cut(s) 104, 119, 148, 206
Bsh1236I CGCG 1 cut(s) 62
BshFI GGCC 4 cut(s) 5, 20, 37, 290
BsiSI CCGG 4 cut(s) 16, 104, 287, 301
BsmAI GTCTC 5 cut(s) 78, 101, 143, 172, 201
BsnI GGCC 4 cut(s) 5, 20, 37, 290
Bso31I GGTCTC 3 cut(s) 101, 143, 201
Bsp143I GATC 5 cut(s) 153, 182, 211, 223, 326
BspACI CCGC 1 cut(s) 87
BspANI GGCC 4 cut(s) 5, 20, 37, 290
BspCNI CTCAG 1 cut(s) 315
BspFNI CGCG 1 cut(s) 62
BspLI GGNNCC 1 cut(s) 99
BspTNI GGTCTC 3 cut(s) 101, 143, 201
BsrDI GCAATG 1 cut(s) 258
BsrFI RCCGGY 2 cut(s) 286, 300
BsrI ACTGG 2 cut(s) 38, 254
BssAI RCCGGY 2 cut(s) 286, 300
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 5 cut(s) 153, 182, 211, 223, 326
Bst2UI CCWGG 2 cut(s) 22, 95
Bst6I CTCTTC 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 323
BstF5I GGATG 1 cut(s) 317
BstFNI CGCG 1 cut(s) 62
BstHHI GCGC 1 cut(s) 64
BstKTI GATC 5 cut(s) 156, 185, 214, 226, 329
BstMAI GTCTC 5 cut(s) 78, 101, 143, 172, 201
BstMBI GATC 5 cut(s) 153, 182, 211, 223, 326
BstNI CCWGG 2 cut(s) 22, 95
BstSCI CCNGG 3 cut(s) 15, 20, 93
BstUI CGCG 1 cut(s) 62
BsuRI GGCC 4 cut(s) 5, 20, 37, 290
BtsCI GGATG 1 cut(s) 317
CfoI GCGC 1 cut(s) 64
Cfr10I RCCGGY 2 cut(s) 286, 300
Cfr13I GGNCC 4 cut(s) 4, 18, 36, 303
CpoI CGGWCCG 1 cut(s) 303
CspI CGGWCCG 1 cut(s) 303
DdeI CTNAG 1 cut(s) 323
DpnI GATC 5 cut(s) 155, 184, 213, 225, 328
DpnII GATC 5 cut(s) 153, 182, 211, 223, 326
EaeI YGGCCR 1 cut(s) 288
Eam1104I CTCTTC 1 cut(s) 192
EarI CTCTTC 1 cut(s) 192
EciI GGCGGA 1 cut(s) 76
Eco31I GGTCTC 3 cut(s) 101, 143, 201
Eco47I GGWCC 1 cut(s) 303
EcoRII CCWGG 2 cut(s) 20, 93
FaiI YATR 2 cut(s) 51, 331
FokI GGATG 1 cut(s) 304
FspBI CTAG 2 cut(s) 12, 278
GlaI GCGC 1 cut(s) 63
HaeIII GGCC 4 cut(s) 5, 20, 37, 290
HapII CCGG 4 cut(s) 16, 104, 287, 301
HhaI GCGC 1 cut(s) 64
Hin6I GCGC 1 cut(s) 62
HinP1I GCGC 1 cut(s) 62
HinfI GANTC 2 cut(s) 71, 241
HpaII CCGG 4 cut(s) 16, 104, 287, 301
HphI GGTGA 1 cut(s) 191
Hpy188I TCNGA 3 cut(s) 70, 223, 307
Hpy99I CGWCG 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 263
HpyF3I CTNAG 1 cut(s) 323
HspAI GCGC 1 cut(s) 62
Kzo9I GATC 5 cut(s) 153, 182, 211, 223, 326
LmnI GCTCC 1 cut(s) 97
MaeI CTAG 2 cut(s) 12, 278
MalI GATC 5 cut(s) 155, 184, 213, 225, 328
MboI GATC 5 cut(s) 153, 182, 211, 223, 326
MboII GAAGA 1 cut(s) 179
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 7 cut(s) 94, 122, 125, 140, 169, 212, 227
MseI TTAA 2 cut(s) 30, 312
MspI CCGG 4 cut(s) 16, 104, 287, 301
MspR9I CCNGG 3 cut(s) 17, 22, 95
MvaI CCWGG 2 cut(s) 22, 95
MvnI CGCG 1 cut(s) 62
NciI CCSGG 1 cut(s) 17
NdeII GATC 5 cut(s) 153, 182, 211, 223, 326
NlaIV GGNNCC 1 cut(s) 99
PfeI GAWTC 1 cut(s) 241
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
Psp6I CCWGG 2 cut(s) 20, 93
PspGI CCWGG 2 cut(s) 20, 93
PspN4I GGNNCC 1 cut(s) 99
PspPI GGNCC 4 cut(s) 4, 18, 36, 303
Rsr2I CGGWCCG 1 cut(s) 303
RsrII CGGWCCG 1 cut(s) 303
SaqAI TTAA 2 cut(s) 30, 312
Sau3AI GATC 5 cut(s) 153, 182, 211, 223, 326
Sau96I GGNCC 4 cut(s) 4, 18, 36, 303
SchI GAGTC 1 cut(s) 80
ScrFI CCNGG 3 cut(s) 17, 22, 95
SetI ASST 2 cut(s) 13, 204
SinI GGWCC 1 cut(s) 303
SsiI CCGC 1 cut(s) 87
SspMI CTAG 2 cut(s) 12, 278
StyD4I CCNGG 3 cut(s) 15, 20, 93
TaqI TCGA 3 cut(s) 152, 181, 210
TfiI GAWTC 1 cut(s) 241
Tru1I TTAA 2 cut(s) 30, 312
Tru9I TTAA 2 cut(s) 30, 312
VpaK11BI GGWCC 1 cut(s) 303
XspI CTAG 2 cut(s) 12, 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.