FvH4_3g01630

Pyridoxal 5'-phosphate (PLP)-binding protein, which may be involved in intracellular homeostatic regulation of pyridoxal 5'-phosphate (PLP), the active form of vitamin B6

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
852844 .. 855245
2402 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g01630.t2

Sequence Viewer

Length: 741 bp
ATGTCCAGCTCCGCCGCAGTCGACGGCGTCGCGGCCACCGCGCTCCGATCAGTTCTCCACCGCGTCCAGCTGGCAGCAGAAAAATCCGGCCGCCGCGCCGACGAGGTCCGGGTGGTGGCGGTGAGCAAGACGAAGCCGGCCGCCGTCCTCCGCCAAGTCTACGACGCCGGCCACCGCTGCTTCGGCGAGAATTACGTCCAGGAAATCGTCGAGAAAGCTCCTCAGCTTCCTGAAGATATAGAGTGGCATTTTATTGGGAATTTGCAGAGCAATAAAGTAAAGCCACTTCTAACTGGTGTGCCCAACCTTGCAATGGTAGAGAGTGTGGATGATGAGAAGATTGCAAACCGTCTTAATACTGTTGTTTCTAGCATTGGGAGAAAGCCTCTTAAGGTGTTGCTCCAAGTGAATACTAGTGGAGAAGAATCAAAATTTGGTGTTGAACCCTCTGGATGTGTGGAGCTCGCAAAGCATGTGAGTTTGGATTGTCCAAACCTTGAGTTTTGTGGTCTAATGACCATTGGTATGTTGGATTATTCATCTACGCCAGAAAACTTTAAGACATTAGCCAACTGCAGAGCTGAGGTCTGCAAGGCACTTGGAATTCCAGTAGAGAAATGTGAGCTATCAATGGGCATGTCTGCGGACTTTGAGCAAGCTATTGAAATGGGAAGCACAAATGTGAGAATTGGATCGACAATATTTGGGCCAAGAGAATATCCAAAGAAACAATCGCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

247

Amino Acids

26.68

Weight (kDa)

6.14

Isoelectric Point (pI)

41.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ala_racemase_N PF01168 18 - 216 1.1e-13 Alanine racemase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012902)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 21, 159
AccII CGCG 4 cut(s) 32, 41, 63, 96
AclWI GGATC 1 cut(s) 700
AcoI YGGCCR 4 cut(s) 33, 88, 138, 169
AcsI RAATTY 3 cut(s) 259, 431, 603
AcuI CTGAAG 1 cut(s) 252
AcyI GRCGYC 2 cut(s) 27, 165
AfiI CCNNNNNNNGG 2 cut(s) 115, 313
AflII CTTAAG 1 cut(s) 389
AgsI TTSAA 2 cut(s) 443, 665
AhlI ACTAGT 1 cut(s) 413
AjnI CCWGG 1 cut(s) 198
AjuI GAANNNNNNNTTGG 2 cut(s) 417, 449
AleI CACNNNNGTG 1 cut(s) 680
AluBI AGCT 8 cut(s) 9, 70, 218, 226, 463, 581, 625, 659
AluI AGCT 8 cut(s) 9, 70, 218, 226, 463, 581, 625, 659
Alw21I GWGCWC 1 cut(s) 465
AlwI GGATC 1 cut(s) 700
AoxI GGCC 5 cut(s) 33, 88, 138, 169, 707
ApeKI GCWGC 2 cut(s) 74, 177
ApoI RAATTY 3 cut(s) 259, 431, 603
AspLEI GCGC 2 cut(s) 43, 98
AspS9I GGNCC 2 cut(s) 106, 707
AsuC2I CCSGG 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 133
AvaII GGWCC 1 cut(s) 106
BaeGI GKGCMC 1 cut(s) 303
BanII GRGCYC 1 cut(s) 465
BarI GAAGNNNNNNTAC 2 cut(s) 270, 302
Bbv12I GWGCWC 1 cut(s) 465
BbvCI CCTCAGC 2 cut(s) 222, 582
BbvI GCAGC 2 cut(s) 86, 164
BceAI ACGGC 2 cut(s) 40, 128
BciT130I CCWGG 1 cut(s) 200
BcnI CCSGG 1 cut(s) 110
BcuI ACTAGT 1 cut(s) 413
BfaI CTAG 2 cut(s) 369, 414
BfmI CTRYAG 1 cut(s) 574
BfrI CTTAAG 1 cut(s) 389
BisI GCNGC 7 cut(s) 15, 33, 75, 91, 94, 141, 178
BlsI GCNGC 7 cut(s) 16, 34, 76, 92, 95, 142, 179
Bme1390I CCNGG 2 cut(s) 110, 200
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 2 cut(s) 106, 707
BmrFI CCNGG 2 cut(s) 110, 200
BplI GAGNNNNNCTC 2 cut(s) 370, 402
Bpu10I CCTNAGC 2 cut(s) 222, 582
BpuEI CTTGAG 1 cut(s) 518
BpuMI CCSGG 1 cut(s) 110
BsaHI GRCGYC 2 cut(s) 27, 165
Bsc4I CCNNNNNNNGG 2 cut(s) 115, 313
Bse118I RCCGGY 2 cut(s) 136, 167
Bse1I ACTGG 2 cut(s) 298, 608
Bse3DI GCAATG 1 cut(s) 318
BseBI CCWGG 1 cut(s) 200
BseGI GGATG 2 cut(s) 334, 458
BseLI CCNNNNNNNGG 2 cut(s) 115, 313
BseMI GCAATG 1 cut(s) 318
BseMII CTCAG 2 cut(s) 236, 573
BseNI ACTGG 2 cut(s) 298, 608
BseRI GAGGAG 1 cut(s) 210
BseSI GKGCMC 1 cut(s) 303
BseX3I CGGCCG 2 cut(s) 88, 138
BseXI GCAGC 2 cut(s) 86, 164
Bsh1236I CGCG 4 cut(s) 32, 41, 63, 96
Bsh1285I CGRYCG 2 cut(s) 91, 141
BshFI GGCC 5 cut(s) 35, 90, 140, 171, 709
BsiEI CGRYCG 2 cut(s) 91, 141
BsiHKAI GWGCWC 1 cut(s) 465
BsiSI CCGG 4 cut(s) 87, 109, 137, 168
BslI CCNNNNNNNGG 2 cut(s) 115, 313
BsnI GGCC 5 cut(s) 35, 90, 140, 171, 709
Bsp1286I GDGCHC 2 cut(s) 303, 465
Bsp143I GATC 2 cut(s) 47, 692
BspANI GGCC 5 cut(s) 35, 90, 140, 171, 709
BspCNI CTCAG 2 cut(s) 235, 574
BspFNI CGCG 4 cut(s) 32, 41, 63, 96
BspMAI CTGCAG 1 cut(s) 578
BspPI GGATC 1 cut(s) 700
BspTI CTTAAG 1 cut(s) 389
BsrDI GCAATG 1 cut(s) 318
BsrFI RCCGGY 2 cut(s) 136, 167
BsrI ACTGG 2 cut(s) 298, 608
BssAI RCCGGY 2 cut(s) 136, 167
BssMI GATC 2 cut(s) 47, 692
BssNI GRCGYC 2 cut(s) 27, 165
Bst2UI CCWGG 1 cut(s) 200
Bst4CI ACNGT 2 cut(s) 350, 361
BstACI GRCGYC 2 cut(s) 27, 165
BstAFI CTTAAG 1 cut(s) 389
BstC8I GCNNGC 5 cut(s) 72, 138, 169, 465, 657
BstDEI CTNAG 3 cut(s) 222, 582, 738
BstF5I GGATG 2 cut(s) 334, 458
BstFNI CGCG 4 cut(s) 32, 41, 63, 96
BstHHI GCGC 2 cut(s) 43, 98
BstKTI GATC 2 cut(s) 50, 695
BstMBI GATC 2 cut(s) 47, 692
BstMCI CGRYCG 2 cut(s) 91, 141
BstMWI GCNNNNNNNGC 4 cut(s) 38, 177, 183, 469
BstNI CCWGG 1 cut(s) 200
BstNSI RCATGY 2 cut(s) 476, 640
BstSCI CCNGG 2 cut(s) 108, 198
BstSFI CTRYAG 1 cut(s) 574
BstSLI GKGCMC 1 cut(s) 303
BstUI CGCG 4 cut(s) 32, 41, 63, 96
BstV1I GCAGC 2 cut(s) 86, 164
BstZI CGGCCG 2 cut(s) 88, 138
BsuRI GGCC 5 cut(s) 35, 90, 140, 171, 709
BtsCI GGATG 2 cut(s) 334, 458
Cac8I GCNNGC 5 cut(s) 72, 138, 169, 465, 657
CfoI GCGC 2 cut(s) 43, 98
Cfr10I RCCGGY 2 cut(s) 136, 167
Cfr13I GGNCC 2 cut(s) 106, 707
CseI GACGC 3 cut(s) 16, 52, 173
CviAII CATG 2 cut(s) 473, 637
DdeI CTNAG 3 cut(s) 222, 582, 738
DpnI GATC 2 cut(s) 49, 694
DpnII GATC 2 cut(s) 47, 692
EaeI YGGCCR 4 cut(s) 33, 88, 138, 169
EagI CGGCCG 2 cut(s) 88, 138
EciI GGCGGA 1 cut(s) 140
Ecl136II GAGCTC 1 cut(s) 463
EclXI CGGCCG 2 cut(s) 88, 138
Eco24I GRGCYC 1 cut(s) 465
Eco47I GGWCC 1 cut(s) 106
Eco52I CGGCCG 2 cut(s) 88, 138
Eco53kI GAGCTC 1 cut(s) 463
Eco57I CTGAAG 1 cut(s) 252
EcoICRI GAGCTC 1 cut(s) 463
EcoRI GAATTC 1 cut(s) 603
EcoRII CCWGG 1 cut(s) 198
EcoT38I GRGCYC 1 cut(s) 465
FaeI CATG 2 cut(s) 476, 640
FaiI YATR 4 cut(s) 239, 474, 527, 638
FatI CATG 2 cut(s) 472, 636
FblI GTMKAC 2 cut(s) 21, 159
Fnu4HI GCNGC 7 cut(s) 15, 33, 75, 91, 94, 141, 178
FokI GGATG 2 cut(s) 341, 465
FriOI GRGCYC 1 cut(s) 465
Fsp4HI GCNGC 7 cut(s) 15, 33, 75, 91, 94, 141, 178
FspBI CTAG 2 cut(s) 369, 414
GlaI GCGC 2 cut(s) 42, 97
GluI GCNGC 7 cut(s) 15, 33, 75, 91, 94, 141, 178
HaeIII GGCC 5 cut(s) 35, 90, 140, 171, 709
HapII CCGG 4 cut(s) 87, 109, 137, 168
HgaI GACGC 3 cut(s) 16, 52, 173
HhaI GCGC 2 cut(s) 43, 98
Hin1I GRCGYC 2 cut(s) 27, 165
Hin1II CATG 2 cut(s) 476, 640
Hin6I GCGC 2 cut(s) 41, 96
HinP1I GCGC 2 cut(s) 41, 96
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 1 cut(s) 425
HpaII CCGG 4 cut(s) 87, 109, 137, 168
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 2 cut(s) 22, 160
Hpy188I TCNGA 1 cut(s) 47
Hpy188III TCNNGA 3 cut(s) 211, 230, 450
Hpy8I GTNNAC 2 cut(s) 22, 160
Hpy99I CGWCG 5 cut(s) 26, 32, 104, 167, 212
HpyCH4III ACNGT 2 cut(s) 350, 361
HpyCH4IV ACGT 1 cut(s) 195
HpyCH4V TGCA 5 cut(s) 265, 311, 344, 576, 591
HpyF10VI GCNNNNNNNGC 4 cut(s) 38, 177, 183, 469
HpyF3I CTNAG 3 cut(s) 222, 582, 738
HpySE526I ACGT 1 cut(s) 195
Hsp92I GRCGYC 2 cut(s) 27, 165
Hsp92II CATG 2 cut(s) 476, 640
HspAI GCGC 2 cut(s) 41, 96
KroI GCCGGC 2 cut(s) 136, 167
KroNI GCCGGC 2 cut(s) 138, 169
Kzo9I GATC 2 cut(s) 47, 692
LmnI GCTCC 5 cut(s) 14, 48, 223, 405, 460
Lsp1109I GCAGC 2 cut(s) 86, 164
MaeI CTAG 2 cut(s) 369, 414
MaeII ACGT 1 cut(s) 195
MalI GATC 2 cut(s) 49, 694
MboI GATC 2 cut(s) 47, 692
MboII GAAGA 3 cut(s) 245, 349, 434
MhlI GDGCHC 2 cut(s) 303, 465
MluCI AATT 5 cut(s) 190, 259, 431, 603, 687
MmeI TCCRAC 1 cut(s) 510
MnlI CCTC 6 cut(s) 97, 158, 231, 396, 457, 577
MroNI GCCGGC 2 cut(s) 136, 167
MseI TTAA 3 cut(s) 354, 390, 558
MslI CAYNNNNRTG 2 cut(s) 524, 680
MspA1I CMGCKG 2 cut(s) 70, 177
MspCI CTTAAG 1 cut(s) 389
MspI CCGG 4 cut(s) 87, 109, 137, 168
MspR9I CCNGG 2 cut(s) 110, 200
MvaI CCWGG 1 cut(s) 200
MvnI CGCG 4 cut(s) 32, 41, 63, 96
MwoI GCNNNNNNNGC 4 cut(s) 38, 177, 183, 469
NaeI GCCGGC 2 cut(s) 138, 169
NciI CCSGG 1 cut(s) 110
NdeII GATC 2 cut(s) 47, 692
NgoMIV GCCGGC 2 cut(s) 136, 167
NlaIII CATG 2 cut(s) 476, 640
NspI RCATGY 2 cut(s) 476, 640
OliI CACNNNNGTG 1 cut(s) 680
PdiI GCCGGC 2 cut(s) 138, 169
PfeI GAWTC 1 cut(s) 425
PflFI GACNNNGTC 2 cut(s) 26, 104
PfoI TCCNGGA 1 cut(s) 198
PkrI GCNGC 7 cut(s) 16, 34, 76, 92, 95, 142, 179
Psp124BI GAGCTC 1 cut(s) 465
Psp6I CCWGG 1 cut(s) 198
PspGI CCWGG 1 cut(s) 198
PspPI GGNCC 2 cut(s) 106, 707
PstI CTGCAG 1 cut(s) 578
PsyI GACNNNGTC 2 cut(s) 26, 104
PvuII CAGCTG 1 cut(s) 70
RseI CAYNNNNRTG 2 cut(s) 524, 680
SacI GAGCTC 1 cut(s) 465
SalI GTCGAC 1 cut(s) 20
SaqAI TTAA 3 cut(s) 354, 390, 558
SatI GCNGC 7 cut(s) 15, 33, 75, 91, 94, 141, 178
Sau3AI GATC 2 cut(s) 47, 692
Sau96I GGNCC 2 cut(s) 106, 707
ScrFI CCNGG 2 cut(s) 110, 200
SduI GDGCHC 2 cut(s) 303, 465
SfcI CTRYAG 1 cut(s) 574
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 2 cut(s) 524, 680
SmlI CTYRAG 2 cut(s) 389, 497
SmoI CTYRAG 2 cut(s) 389, 497
SpeI ACTAGT 1 cut(s) 413
Sse9I AATT 5 cut(s) 190, 259, 431, 603, 687
SspI AATATT 1 cut(s) 702
SspMI CTAG 2 cut(s) 369, 414
SstI GAGCTC 1 cut(s) 465
StyD4I CCNGG 2 cut(s) 108, 198
TaaI ACNGT 2 cut(s) 350, 361
TaiI ACGT 1 cut(s) 198
TaqI TCGA 3 cut(s) 21, 210, 695
TasI AATT 5 cut(s) 190, 259, 431, 603, 687
TauI GCSGC 5 cut(s) 17, 35, 93, 96, 143
TfiI GAWTC 1 cut(s) 425
Tru1I TTAA 3 cut(s) 354, 390, 558
Tru9I TTAA 3 cut(s) 354, 390, 558
TseI GCWGC 2 cut(s) 74, 177
TspDTI ATGAA 1 cut(s) 528
Tth111I GACNNNGTC 2 cut(s) 26, 104
Vha464I CTTAAG 1 cut(s) 389
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 3 cut(s) 259, 431, 603
XceI RCATGY 2 cut(s) 476, 640
XcmI CCANNNNNNNNNTGG 2 cut(s) 310, 526
XmiI GTMKAC 2 cut(s) 21, 159
XspI CTAG 2 cut(s) 369, 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.