FvH4_3g10630

germin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0016285
Physical Location & Seq
Reverse (-)
6340114 .. 6341567
1454 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g10630.t2

Sequence Viewer

Length: 651 bp
ATGGTCACTTATAATATCTTCTTTGGGCTCCTATTATCTTTCTCTTTGTCGGTTGCCACTGCATCTGATAATAGTCCACTTCAAGATTTCTGTGTGGCAGACCCAGAAAGTGGAGTGCTGATGAATGGCCTAGCTTGCAAGGACCCCAAGGCAGTTGAAGCCAACGACTTCTCATTTGGTGGGCTTCACTTAGCAGCCAATACATCAAACCCAATAGGGTCTAGTGTGACACCAGTGACTGTATCCCAACTTCCAGGACTCAACACCCTTGGCATTTCACTAGTGCGCATCGACTATGCATCATCAGGCATCAACCCTCCCCACACTCATCCTCGTGCCTCCGAAGTCTTGACCCTCCTTGAAGGCAGCCTTGAAGTTGGGTTCGTAACGTCGAGCCCCGAGAATCGTCACATCACCAAGGTGTTGCACAAGGGTGATGTGTTTGTTTTCCCAATCGGTCTAGTTCACTACCAGAGAAATGTGGGAAGTGGCAATGCTGTTGCTATTGCTGCTCTGAGCAGCCAAAATCCTGGTGTGGTAATACTTGCAAGTGCTGTCTTTGGGTCCAGGCCAAGTATTGGTAGTGACATTCTTGTGAAGGCATTGCAAGTTGATAGAGGGGTTGTCAATTACCTCCAATCCATATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cupin_1

Protein Analysis

217

Amino Acids

22.6

Weight (kDa)

5.79

Isoelectric Point (pI)

40.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cupin_1 PF00190 59 - 200 1.1e-45 Cupin
Cupin_2 PF07883 93 - 163 2.8e-09 Cupin domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016285)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g10630 FvH4_3g10630
malus_domestica MD05G1269800.v1.1
prunus_persica Prupe.4G094700_v2.0.a1
pyrus_communis pycom05g25270
rosa_chinensis RchiOBHm_Chr5g0017341
rosa_laevigata RLG00000032275
rosa_multiflora Rmu_sc0005223.1_g000005 Rmu_sc0005319.1_g000008
rosa_roxburghii Rroxscaffold_1G00060020
rosa_rugosa Rorug05G0034100
rosa_samantha Rh5AG129200 Rh5BG127000 Rh5CG139800
rosa_wichuraiana Rw5G011160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 12
Acc16I TGCGCA 1 cut(s) 287
AccB7I CCANNNNNTGG 2 cut(s) 110, 578
AfiI CCNNNNNNNGG 2 cut(s) 110, 578
AgsI TTSAA 4 cut(s) 83, 158, 362, 374
AhlI ACTAGT 1 cut(s) 280
AjnI CCWGG 3 cut(s) 253, 529, 566
AleI CACNNNNGTG 2 cut(s) 419, 432
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
AlwNI CAGNNNCTG 1 cut(s) 239
Ama87I CYCGRG 1 cut(s) 398
AoxI GGCC 2 cut(s) 127, 569
ApeKI GCWGC 4 cut(s) 194, 366, 509, 519
ArsI GACNNNNNNTTYG 2 cut(s) 158, 190
AspLEI GCGC 1 cut(s) 288
AspS9I GGNCC 2 cut(s) 142, 564
AsuHPI GGTGA 2 cut(s) 406, 446
AvaI CYCGRG 1 cut(s) 398
AvaII GGWCC 2 cut(s) 142, 564
BanII GRGCYC 2 cut(s) 30, 398
BarI GAAGNNNNNNTAC 2 cut(s) 234, 266
BauI CACGAG 1 cut(s) 333
BbvI GCAGC 4 cut(s) 206, 378, 496, 531
BciT130I CCWGG 3 cut(s) 255, 531, 568
BciVI GTATCC 1 cut(s) 253
BcuI ACTAGT 1 cut(s) 280
BfaI CTAG 5 cut(s) 131, 222, 281, 461, 649
BfuI GTATCC 1 cut(s) 253
BisI GCNGC 4 cut(s) 195, 367, 510, 520
BlsI GCNGC 4 cut(s) 196, 368, 511, 521
Bme1390I CCNGG 3 cut(s) 255, 531, 568
Bme18I GGWCC 2 cut(s) 142, 564
BmeT110I CYCGRG 1 cut(s) 398
BmgT120I GGNCC 2 cut(s) 142, 564
BmiI GGNNCC 3 cut(s) 29, 144, 565
BmrFI CCNGG 3 cut(s) 255, 531, 568
BmsI GCATC 4 cut(s) 71, 297, 308, 318
BsaJI CCNNGG 3 cut(s) 147, 268, 417
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 578
Bse1I ACTGG 1 cut(s) 233
Bse3DI GCAATG 2 cut(s) 499, 602
BseBI CCWGG 3 cut(s) 255, 531, 568
BseDI CCNNGG 3 cut(s) 147, 268, 417
BseGI GGATG 1 cut(s) 328
BseLI CCNNNNNNNGG 2 cut(s) 110, 578
BseMI GCAATG 2 cut(s) 499, 602
BseMII CTCAG 1 cut(s) 506
BseNI ACTGG 1 cut(s) 233
BseXI GCAGC 4 cut(s) 206, 378, 496, 531
BshFI GGCC 2 cut(s) 129, 571
BsiHKCI CYCGRG 1 cut(s) 398
BslI CCNNNNNNNGG 2 cut(s) 110, 578
BsnI GGCC 2 cut(s) 129, 571
BsoBI CYCGRG 1 cut(s) 398
Bsp1286I GDGCHC 2 cut(s) 30, 398
BspANI GGCC 2 cut(s) 129, 571
BspCNI CTCAG 1 cut(s) 507
BspLI GGNNCC 3 cut(s) 29, 144, 565
BsrDI GCAATG 2 cut(s) 499, 602
BsrI ACTGG 1 cut(s) 233
BssECI CCNNGG 3 cut(s) 147, 268, 417
BssSI CACGAG 1 cut(s) 333
BssT1I CCWWGG 3 cut(s) 147, 268, 417
Bst2BI CACGAG 1 cut(s) 333
Bst2UI CCWGG 3 cut(s) 255, 531, 568
Bst4CI ACNGT 1 cut(s) 241
BstC8I GCNNGC 1 cut(s) 136
BstDEI CTNAG 2 cut(s) 190, 515
BstF5I GGATG 1 cut(s) 328
BstHHI GCGC 1 cut(s) 288
BstMWI GCNNNNNNNGC 3 cut(s) 135, 158, 509
BstNI CCWGG 3 cut(s) 255, 531, 568
BstSCI CCNGG 3 cut(s) 253, 529, 566
BstV1I GCAGC 4 cut(s) 206, 378, 496, 531
BstXI CCANNNNNNTGG 1 cut(s) 530
BsuI GTATCC 1 cut(s) 253
BsuRI GGCC 2 cut(s) 129, 571
BtsCI GGATG 1 cut(s) 328
BtsI GCAGTG 1 cut(s) 57
BtsIMutI CAGTG 2 cut(s) 57, 240
Cac8I GCNNGC 1 cut(s) 136
CaiI CAGNNNCTG 1 cut(s) 239
CfoI GCGC 1 cut(s) 288
Cfr13I GGNCC 2 cut(s) 142, 564
DdeI CTNAG 2 cut(s) 190, 515
Eco130I CCWWGG 3 cut(s) 147, 268, 417
Eco24I GRGCYC 2 cut(s) 30, 398
Eco47I GGWCC 2 cut(s) 142, 564
Eco88I CYCGRG 1 cut(s) 398
EcoO109I RGGNCCY 1 cut(s) 142
EcoRII CCWGG 3 cut(s) 253, 529, 566
EcoT14I CCWWGG 3 cut(s) 147, 268, 417
EcoT22I ATGCAT 1 cut(s) 301
EcoT38I GRGCYC 2 cut(s) 30, 398
ErhI CCWWGG 3 cut(s) 147, 268, 417
FaiI YATR 3 cut(s) 12, 297, 644
FalI AAGNNNNNCTT 2 cut(s) 354, 386
Fnu4HI GCNGC 4 cut(s) 195, 367, 510, 520
FokI GGATG 1 cut(s) 315
FriOI GRGCYC 2 cut(s) 30, 398
Fsp4HI GCNGC 4 cut(s) 195, 367, 510, 520
FspAI RTGCGCAY 1 cut(s) 287
FspBI CTAG 5 cut(s) 131, 222, 281, 461, 649
FspI TGCGCA 1 cut(s) 287
GlaI GCGC 1 cut(s) 287
GluI GCNGC 4 cut(s) 195, 367, 510, 520
HaeIII GGCC 2 cut(s) 129, 571
HhaI GCGC 1 cut(s) 288
Hin6I GCGC 1 cut(s) 286
HinP1I GCGC 1 cut(s) 286
HinfI GANTC 2 cut(s) 258, 403
HphI GGTGA 2 cut(s) 406, 446
Hpy166II GTNNAC 2 cut(s) 77, 466
Hpy188I TCNGA 3 cut(s) 67, 343, 516
Hpy188III TCNNGA 2 cut(s) 83, 349
Hpy8I GTNNAC 2 cut(s) 77, 466
Hpy99I CGWCG 1 cut(s) 394
HpyAV CCTTC 2 cut(s) 356, 592
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 1 cut(s) 389
HpyCH4V TGCA 6 cut(s) 62, 138, 299, 427, 548, 607
HpyF10VI GCNNNNNNNGC 3 cut(s) 135, 158, 509
HpyF3I CTNAG 2 cut(s) 190, 515
HpySE526I ACGT 1 cut(s) 389
HspAI GCGC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 33
Lsp1109I GCAGC 4 cut(s) 206, 378, 496, 531
LweI GCATC 4 cut(s) 71, 297, 308, 318
MaeI CTAG 5 cut(s) 131, 222, 281, 461, 649
MaeII ACGT 1 cut(s) 389
MaeIII GTNAC 6 cut(s) 4, 226, 235, 385, 407, 584
MboII GAAGA 1 cut(s) 10
MhlI GDGCHC 2 cut(s) 30, 398
MluCI AATT 1 cut(s) 628
MlyI GAGTC 1 cut(s) 252
MnlI CCTC 6 cut(s) 327, 342, 349, 365, 611, 644
Mph1103I ATGCAT 1 cut(s) 301
MslI CAYNNNNRTG 4 cut(s) 333, 419, 432, 593
MspR9I CCNGG 3 cut(s) 255, 531, 568
MvaI CCWGG 3 cut(s) 255, 531, 568
MwoI GCNNNNNNNGC 3 cut(s) 135, 158, 509
NlaIV GGNNCC 3 cut(s) 29, 144, 565
NmuCI GTSAC 5 cut(s) 4, 226, 235, 407, 584
NsbI TGCGCA 1 cut(s) 287
NsiI ATGCAT 1 cut(s) 301
OliI CACNNNNGTG 2 cut(s) 419, 432
PfeI GAWTC 1 cut(s) 403
PflMI CCANNNNNTGG 2 cut(s) 110, 578
PfoI TCCNGGA 1 cut(s) 253
PkrI GCNGC 4 cut(s) 196, 368, 511, 521
PleI GAGTC 1 cut(s) 252
PpsI GAGTC 1 cut(s) 252
PpuMI RGGWCCY 1 cut(s) 142
PsiI TTATAA 1 cut(s) 12
Psp5II RGGWCCY 1 cut(s) 142
Psp6I CCWGG 3 cut(s) 253, 529, 566
PspGI CCWGG 3 cut(s) 253, 529, 566
PspN4I GGNNCC 3 cut(s) 29, 144, 565
PspPI GGNCC 2 cut(s) 142, 564
PspPPI RGGWCCY 1 cut(s) 142
PstNI CAGNNNCTG 1 cut(s) 239
RseI CAYNNNNRTG 4 cut(s) 333, 419, 432, 593
SatI GCNGC 4 cut(s) 195, 367, 510, 520
Sau96I GGNCC 2 cut(s) 142, 564
SchI GAGTC 1 cut(s) 252
ScrFI CCNGG 3 cut(s) 255, 531, 568
SduI GDGCHC 2 cut(s) 30, 398
SetI ASST 4 cut(s) 136, 392, 423, 636
SfaNI GCATC 4 cut(s) 71, 297, 308, 318
SinI GGWCC 2 cut(s) 142, 564
SmiMI CAYNNNNRTG 4 cut(s) 333, 419, 432, 593
SpeI ACTAGT 1 cut(s) 280
Sse9I AATT 1 cut(s) 628
SspMI CTAG 5 cut(s) 131, 222, 281, 461, 649
StyD4I CCNGG 3 cut(s) 253, 529, 566
StyI CCWWGG 3 cut(s) 147, 268, 417
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 1 cut(s) 392
TaqI TCGA 2 cut(s) 291, 392
TaqII GACCGA 1 cut(s) 446
TasI AATT 1 cut(s) 628
TfiI GAWTC 1 cut(s) 403
TscAI CASTG 2 cut(s) 64, 240
TseFI GTSAC 5 cut(s) 4, 226, 235, 407, 584
TseI GCWGC 4 cut(s) 194, 366, 509, 519
Tsp45I GTSAC 5 cut(s) 4, 226, 235, 407, 584
TspDTI ATGAA 1 cut(s) 137
TspRI CASTG 2 cut(s) 64, 240
Van91I CCANNNNNTGG 2 cut(s) 110, 578
VpaK11BI GGWCC 2 cut(s) 142, 564
XspI CTAG 5 cut(s) 131, 222, 281, 461, 649
Zsp2I ATGCAT 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.