Rmu_sc0005319.1_g000008

germin-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005319.1
Physical Location & Seq
Forward (+)
22117 .. 22650
534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005319.1_g000008.1.cds

Sequence Viewer

Length: 534 bp
ctgctgaatggcctagcttgcaaggaccccaagacagttaaagccaacgatttttcatttggtgggcttcacttagcagccaatacatcaaacccaattgggtcaagtgtgacaccggtgaccgtatcccaacttccaggactcaatactcttggcatttcactagtccgcatcgactatgcaccatcaggcatcaaccctccccacattcatcctcgtgcctccgaaatcttgaccatccttgaaggctgccttgaagttgggttcgtaacgtcgagccccgaaaatcgtcacatcaccaaggtgttgcagaagggcgatgtgtttgttttcccaatcggactcgtccactaccagagaaatgtaggaactggcaatgctgttgctattgctgccctgagcagccaaaatcctggtgtggtaataattgcaagtgctgtctttgggtccaggcctagtattggtagtgagattctcgtaaaggctttgcaagttgatcaaggggttgtcaattacctccagtccatattctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

177

Amino Acids

18.52

Weight (kDa)

8.02

Isoelectric Point (pI)

49.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016285)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g10630 FvH4_3g10630
malus_domestica MD05G1269800.v1.1
prunus_persica Prupe.4G094700_v2.0.a1
pyrus_communis pycom05g25270
rosa_chinensis RchiOBHm_Chr5g0017341
rosa_laevigata RLG00000032275
rosa_multiflora Rmu_sc0005223.1_g000005 Rmu_sc0005319.1_g000008
rosa_roxburghii Rroxscaffold_1G00060020
rosa_rugosa Rorug05G0034100
rosa_samantha Rh5AG129200 Rh5BG127000 Rh5CG139800
rosa_wichuraiana Rw5G011160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AfiI CCNNNNNNNGG 1 cut(s) 461
AgeI ACCGGT 1 cut(s) 115
AgsI TTSAA 2 cut(s) 245, 257
AhlI ACTAGT 1 cut(s) 163
AjnI CCWGG 3 cut(s) 136, 412, 449
AleI CACNNNNGTG 1 cut(s) 302
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
AoxI GGCC 2 cut(s) 10, 452
ApeKI GCWGC 4 cut(s) 77, 249, 392, 402
AsiGI ACCGGT 1 cut(s) 115
AspS9I GGNCC 2 cut(s) 25, 447
AsuHPI GGTGA 2 cut(s) 130, 289
AvaII GGWCC 2 cut(s) 25, 447
BanII GRGCYC 1 cut(s) 281
BarI GAAGNNNNNNTAC 2 cut(s) 117, 149
BauI CACGAG 1 cut(s) 216
BbvI GCAGC 4 cut(s) 89, 236, 379, 414
BccI CCATC 2 cut(s) 193, 245
BciT130I CCWGG 3 cut(s) 138, 414, 451
BciVI GTATCC 1 cut(s) 136
BclI TGATCA 1 cut(s) 496
BcuI ACTAGT 1 cut(s) 163
BfaI CTAG 3 cut(s) 14, 164, 456
BfuI GTATCC 1 cut(s) 136
BisI GCNGC 4 cut(s) 78, 250, 393, 403
BlsI GCNGC 4 cut(s) 79, 251, 394, 404
Bme1390I CCNGG 3 cut(s) 138, 414, 451
Bme18I GGWCC 2 cut(s) 25, 447
BmgT120I GGNCC 2 cut(s) 25, 447
BmiI GGNNCC 2 cut(s) 27, 448
BmrFI CCNGG 3 cut(s) 138, 414, 451
BmsI GCATC 2 cut(s) 180, 201
BpmI CTGGAG 1 cut(s) 503
Bpu10I CCTNAGC 1 cut(s) 398
BsaJI CCNNGG 1 cut(s) 300
BsaWI WCCGGW 1 cut(s) 115
Bsc4I CCNNNNNNNGG 1 cut(s) 461
Bse118I RCCGGY 1 cut(s) 115
Bse1I ACTGG 2 cut(s) 376, 520
Bse3DI GCAATG 1 cut(s) 382
BseBI CCWGG 3 cut(s) 138, 414, 451
BseDI CCNNGG 1 cut(s) 300
BseGI GGATG 2 cut(s) 211, 237
BseLI CCNNNNNNNGG 1 cut(s) 461
BseMI GCAATG 1 cut(s) 382
BseMII CTCAG 1 cut(s) 389
BseNI ACTGG 2 cut(s) 376, 520
BseXI GCAGC 4 cut(s) 89, 236, 379, 414
BshFI GGCC 2 cut(s) 12, 454
BshTI ACCGGT 1 cut(s) 115
BsiSI CCGG 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 461
BsnI GGCC 2 cut(s) 12, 454
Bsp1286I GDGCHC 1 cut(s) 281
Bsp143I GATC 1 cut(s) 496
BspACI CCGC 1 cut(s) 169
BspANI GGCC 2 cut(s) 12, 454
BspCNI CTCAG 1 cut(s) 390
BspLI GGNNCC 2 cut(s) 27, 448
BsrDI GCAATG 1 cut(s) 382
BsrFI RCCGGY 1 cut(s) 115
BsrI ACTGG 2 cut(s) 376, 520
BssAI RCCGGY 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 300
BssMI GATC 1 cut(s) 496
BssSI CACGAG 1 cut(s) 216
BssT1I CCWWGG 1 cut(s) 300
Bst2BI CACGAG 1 cut(s) 216
Bst2UI CCWGG 3 cut(s) 138, 414, 451
Bst4CI ACNGT 2 cut(s) 37, 124
BstC8I GCNNGC 1 cut(s) 19
BstDEI CTNAG 2 cut(s) 73, 398
BstEII GGTNACC 1 cut(s) 118
BstF5I GGATG 2 cut(s) 211, 237
BstKTI GATC 1 cut(s) 499
BstMBI GATC 1 cut(s) 496
BstMWI GCNNNNNNNGC 2 cut(s) 18, 392
BstNI CCWGG 3 cut(s) 138, 414, 451
BstPI GGTNACC 1 cut(s) 118
BstSCI CCNGG 3 cut(s) 136, 412, 449
BstV1I GCAGC 4 cut(s) 89, 236, 379, 414
BstXI CCANNNNNNTGG 1 cut(s) 413
BsuI GTATCC 1 cut(s) 136
BsuRI GGCC 2 cut(s) 12, 454
BtgZI GCGATG 1 cut(s) 333
BtsCI GGATG 2 cut(s) 211, 237
Cac8I GCNNGC 1 cut(s) 19
Cfr10I RCCGGY 1 cut(s) 115
Cfr13I GGNCC 2 cut(s) 25, 447
CspAI ACCGGT 1 cut(s) 115
DdeI CTNAG 2 cut(s) 73, 398
DpnI GATC 1 cut(s) 498
DpnII GATC 1 cut(s) 496
Eco130I CCWWGG 1 cut(s) 300
Eco147I AGGCCT 1 cut(s) 454
Eco24I GRGCYC 1 cut(s) 281
Eco47I GGWCC 2 cut(s) 25, 447
Eco91I GGTNACC 1 cut(s) 118
EcoO109I RGGNCCY 1 cut(s) 25
EcoO65I GGTNACC 1 cut(s) 118
EcoRII CCWGG 3 cut(s) 136, 412, 449
EcoT14I CCWWGG 1 cut(s) 300
EcoT38I GRGCYC 1 cut(s) 281
ErhI CCWWGG 1 cut(s) 300
FaiI YATR 2 cut(s) 180, 527
FalI AAGNNNNNCTT 2 cut(s) 237, 269
FbaI TGATCA 1 cut(s) 496
Fnu4HI GCNGC 4 cut(s) 78, 250, 393, 403
FokI GGATG 2 cut(s) 198, 224
FriOI GRGCYC 1 cut(s) 281
Fsp4HI GCNGC 4 cut(s) 78, 250, 393, 403
FspBI CTAG 3 cut(s) 14, 164, 456
GluI GCNGC 4 cut(s) 78, 250, 393, 403
GsuI CTGGAG 1 cut(s) 503
HaeIII GGCC 2 cut(s) 12, 454
HapII CCGG 1 cut(s) 116
HinfI GANTC 3 cut(s) 141, 342, 472
HpaII CCGG 1 cut(s) 116
HphI GGTGA 2 cut(s) 130, 289
Hpy166II GTNNAC 1 cut(s) 349
Hpy188I TCNGA 2 cut(s) 226, 341
Hpy188III TCNNGA 1 cut(s) 232
Hpy8I GTNNAC 1 cut(s) 349
Hpy99I CGWCG 1 cut(s) 277
HpyAV CCTTC 2 cut(s) 239, 307
HpyCH4III ACNGT 2 cut(s) 37, 124
HpyCH4IV ACGT 1 cut(s) 272
HpyCH4V TGCA 5 cut(s) 21, 182, 310, 431, 490
HpyF10VI GCNNNNNNNGC 2 cut(s) 18, 392
HpyF3I CTNAG 2 cut(s) 73, 398
HpySE526I ACGT 1 cut(s) 272
Ksp22I TGATCA 1 cut(s) 496
Kzo9I GATC 1 cut(s) 496
Lsp1109I GCAGC 4 cut(s) 89, 236, 379, 414
LweI GCATC 2 cut(s) 180, 201
MaeI CTAG 3 cut(s) 14, 164, 456
MaeII ACGT 1 cut(s) 272
MaeIII GTNAC 4 cut(s) 109, 118, 268, 290
MalI GATC 1 cut(s) 498
MboI GATC 1 cut(s) 496
MfeI CAATTG 1 cut(s) 96
MhlI GDGCHC 1 cut(s) 281
MluCI AATT 3 cut(s) 96, 426, 511
MlyI GAGTC 2 cut(s) 135, 336
MnlI CCTC 4 cut(s) 210, 225, 232, 527
MseI TTAA 1 cut(s) 39
MslI CAYNNNNRTG 2 cut(s) 216, 302
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 3 cut(s) 138, 414, 451
MunI CAATTG 1 cut(s) 96
MvaI CCWGG 3 cut(s) 138, 414, 451
MwoI GCNNNNNNNGC 2 cut(s) 18, 392
NdeII GATC 1 cut(s) 496
NlaIV GGNNCC 2 cut(s) 27, 448
NmuCI GTSAC 3 cut(s) 109, 118, 290
OliI CACNNNNGTG 1 cut(s) 302
PceI AGGCCT 1 cut(s) 454
PfeI GAWTC 1 cut(s) 472
PfoI TCCNGGA 1 cut(s) 136
PinAI ACCGGT 1 cut(s) 115
PkrI GCNGC 4 cut(s) 79, 251, 394, 404
PleI GAGTC 2 cut(s) 135, 336
PpsI GAGTC 2 cut(s) 135, 336
PpuMI RGGWCCY 1 cut(s) 25
Psp5II RGGWCCY 1 cut(s) 25
Psp6I CCWGG 3 cut(s) 136, 412, 449
PspEI GGTNACC 1 cut(s) 118
PspGI CCWGG 3 cut(s) 136, 412, 449
PspN4I GGNNCC 2 cut(s) 27, 448
PspPI GGNCC 2 cut(s) 25, 447
PspPPI RGGWCCY 1 cut(s) 25
RseI CAYNNNNRTG 2 cut(s) 216, 302
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 4 cut(s) 78, 250, 393, 403
Sau3AI GATC 1 cut(s) 496
Sau96I GGNCC 2 cut(s) 25, 447
SchI GAGTC 2 cut(s) 135, 336
ScrFI CCNGG 3 cut(s) 138, 414, 451
SduI GDGCHC 1 cut(s) 281
SetI ASST 4 cut(s) 19, 275, 306, 519
SfaNI GCATC 2 cut(s) 180, 201
SgrAI CRCCGGYG 1 cut(s) 115
SinI GGWCC 2 cut(s) 25, 447
SmiMI CAYNNNNRTG 2 cut(s) 216, 302
SpeI ACTAGT 1 cut(s) 163
Sse9I AATT 3 cut(s) 96, 426, 511
SseBI AGGCCT 1 cut(s) 454
SsiI CCGC 1 cut(s) 169
SspMI CTAG 3 cut(s) 14, 164, 456
StuI AGGCCT 1 cut(s) 454
StyD4I CCNGG 3 cut(s) 136, 412, 449
StyI CCWWGG 1 cut(s) 300
TaaI ACNGT 2 cut(s) 37, 124
TaiI ACGT 1 cut(s) 275
TaqI TCGA 2 cut(s) 174, 275
TasI AATT 3 cut(s) 96, 426, 511
TfiI GAWTC 1 cut(s) 472
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TseFI GTSAC 3 cut(s) 109, 118, 290
TseI GCWGC 4 cut(s) 77, 249, 392, 402
Tsp45I GTSAC 3 cut(s) 109, 118, 290
TspDTI ATGAA 2 cut(s) 45, 200
VpaK11BI GGWCC 2 cut(s) 25, 447
XspI CTAG 3 cut(s) 14, 164, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.