FvH4_4g06540

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Reverse (-)
5805067 .. 5806140
1074 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g06540.t1

Sequence Viewer

Length: 300 bp
ATGAAAAGTTTGCATATAGTTCTATTCTCTTTCCTTGTTACAGTTCTTTATCTTTCTTCCCATAACATCAGTTCCTCTTCTCTGAGTATTCCCCCTAGAAGACAACCAATAAGGAAACTGAGCATGTCATTCATCAACAAGATACATGAAAATCCAAAGATCAAGGTCATTGATGGAGAATCCGAAACTTCAACTGTCCAAGAAAATAGCAATAGTAATATAGACGATATTGTCTACCAGATTGATTACCATGGAGTGACTACTCATCCGACTCCAACACCCAGGCACTCCAAACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.2

Weight (kDa)

9.1

Isoelectric Point (pI)

48.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017642)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g06540
malus_domestica MD16G1241400.v1.1
prunus_persica Prupe.1G068200_v2.0.a1
pyrus_communis pycom16g20230
rosa_chinensis RchiOBHm_Chr4g0398461
rosa_roxburghii Rroxscaffold_5G00343420
rosa_rugosa Rorug04G0008100
rosa_samantha Rh4AG086300 Rh4BG083200 Rh4CG094100 Rh4DG078000
rosa_wichuraiana Rw4G007220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 230
AccI GTMKAC 1 cut(s) 234
AgsI TTSAA 1 cut(s) 192
AjnI CCWGG 1 cut(s) 281
BbsI GAAGAC 1 cut(s) 106
BccI CCATC 1 cut(s) 167
BciT130I CCWGG 1 cut(s) 283
BfaI CTAG 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 283
BmrFI CCNGG 1 cut(s) 283
BpiI GAAGAC 1 cut(s) 106
BsaJI CCNNGG 2 cut(s) 250, 281
BseBI CCWGG 1 cut(s) 283
BseDI CCNNGG 2 cut(s) 250, 281
BseGI GGATG 1 cut(s) 265
BseMII CTCAG 2 cut(s) 74, 110
Bsp143I GATC 1 cut(s) 159
Bsp19I CCATGG 1 cut(s) 250
BspCNI CTCAG 2 cut(s) 75, 111
BssECI CCNNGG 2 cut(s) 250, 281
BssMI GATC 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 250
Bst2UI CCWGG 1 cut(s) 283
Bst4CI ACNGT 2 cut(s) 43, 196
Bst6I CTCTTC 1 cut(s) 82
BstDEI CTNAG 2 cut(s) 83, 119
BstDSI CCRYGG 1 cut(s) 250
BstF5I GGATG 1 cut(s) 265
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 283
BstNSI RCATGY 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 281
BstV2I GAAGAC 1 cut(s) 106
BtgI CCRYGG 1 cut(s) 250
BtsCI GGATG 1 cut(s) 265
CviAII CATG 3 cut(s) 124, 146, 251
DdeI CTNAG 2 cut(s) 83, 119
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
DrdI GACNNNNNNGTC 1 cut(s) 230
DseDI GACNNNNNNGTC 1 cut(s) 230
Eam1104I CTCTTC 1 cut(s) 82
EarI CTCTTC 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 250
EcoRII CCWGG 1 cut(s) 281
EcoT14I CCWWGG 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 250
FaeI CATG 3 cut(s) 127, 149, 254
FaiI YATR 8 cut(s) 15, 17, 63, 125, 147, 221, 252, 298
FatI CATG 3 cut(s) 123, 145, 250
FblI GTMKAC 1 cut(s) 234
FokI GGATG 1 cut(s) 252
FspBI CTAG 1 cut(s) 96
Hin1II CATG 3 cut(s) 127, 149, 254
HinfI GANTC 2 cut(s) 179, 271
Hpy166II GTNNAC 1 cut(s) 235
Hpy188I TCNGA 3 cut(s) 84, 184, 270
Hpy8I GTNNAC 1 cut(s) 235
HpyCH4III ACNGT 2 cut(s) 43, 196
HpyCH4V TGCA 1 cut(s) 13
HpyF3I CTNAG 2 cut(s) 83, 119
Hsp92II CATG 3 cut(s) 127, 149, 254
Kzo9I GATC 1 cut(s) 159
LpnPI CCDG 3 cut(s) 251, 268, 295
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 2 cut(s) 37, 256
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 3 cut(s) 48, 69, 111
MlyI GAGTC 1 cut(s) 265
MmeI TCCRAC 2 cut(s) 293, 299
MnlI CCTC 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 283
MvaI CCWGG 1 cut(s) 283
NcoI CCATGG 1 cut(s) 250
NdeII GATC 1 cut(s) 159
NlaIII CATG 3 cut(s) 127, 149, 254
NmuCI GTSAC 1 cut(s) 256
NspI RCATGY 1 cut(s) 127
PfeI GAWTC 1 cut(s) 179
PleI GAGTC 1 cut(s) 265
PpsI GAGTC 1 cut(s) 265
Psp6I CCWGG 1 cut(s) 281
PspGI CCWGG 1 cut(s) 281
Sau3AI GATC 1 cut(s) 159
SchI GAGTC 1 cut(s) 265
ScrFI CCNGG 1 cut(s) 283
SetI ASST 1 cut(s) 168
SspMI CTAG 1 cut(s) 96
StyD4I CCNGG 1 cut(s) 281
StyI CCWWGG 1 cut(s) 250
TaaI ACNGT 2 cut(s) 43, 196
TfiI GAWTC 1 cut(s) 179
TseFI GTSAC 1 cut(s) 256
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 3 cut(s) 17, 121, 162
XceI RCATGY 1 cut(s) 127
XmiI GTMKAC 1 cut(s) 234
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.