Rh4BG083200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
14435514 .. 14435992
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG083200.1

Sequence Viewer

Length: 264 bp
ATGAGTTCCTCTTCTGTGTCTCTGAGTATTCTCCCAGGAAGACAACCAATAAGGAAATTGAGCATGTCATTCACCAACAAGAAACATGAAAATCCAAAGATCAAGGTCATTGATGGAGACTCGGAAACATCGATGGTCCAAGAGAATCCAGTTTCAAACAAATATGCAAGTATCAATAGTAATATAGACGATATTGTTTACCAGATTGATTACCATGGAGTGACTACTCATCCGACTCCAACACCCAGACACTCCAAACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.68

Weight (kDa)

9.05

Isoelectric Point (pI)

48.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017642)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g06540
malus_domestica MD16G1241400.v1.1
prunus_persica Prupe.1G068200_v2.0.a1
pyrus_communis pycom16g20230
rosa_chinensis RchiOBHm_Chr4g0398461
rosa_roxburghii Rroxscaffold_5G00343420
rosa_rugosa Rorug04G0008100
rosa_samantha Rh4AG086300 Rh4BG083200 Rh4CG094100 Rh4DG078000
rosa_wichuraiana Rw4G007220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 156
AjnI CCWGG 1 cut(s) 34
Alw26I GTCTC 2 cut(s) 24, 111
AspS9I GGNCC 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 64
AvaII GGWCC 1 cut(s) 136
BbsI GAAGAC 1 cut(s) 46
BccI CCATC 2 cut(s) 107, 127
BciT130I CCWGG 1 cut(s) 36
BcoDI GTCTC 2 cut(s) 24, 111
Bme1390I CCNGG 1 cut(s) 36
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 36
BpiI GAAGAC 1 cut(s) 46
Bsa29I ATCGAT 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 34, 214
Bse1I ACTGG 1 cut(s) 149
BseBI CCWGG 1 cut(s) 36
BseCI ATCGAT 1 cut(s) 131
BseDI CCNNGG 2 cut(s) 34, 214
BseGI GGATG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 14
BseNI ACTGG 1 cut(s) 149
BshVI ATCGAT 1 cut(s) 131
BsmAI GTCTC 2 cut(s) 24, 111
Bsp143I GATC 1 cut(s) 99
Bsp19I CCATGG 1 cut(s) 214
BspCNI CTCAG 1 cut(s) 15
BspDI ATCGAT 1 cut(s) 131
BsrI ACTGG 1 cut(s) 149
BssECI CCNNGG 2 cut(s) 34, 214
BssMI GATC 1 cut(s) 99
BssT1I CCWWGG 1 cut(s) 214
Bst2UI CCWGG 1 cut(s) 36
Bst6I CTCTTC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 23
BstDSI CCRYGG 1 cut(s) 214
BstF5I GGATG 1 cut(s) 229
BstKTI GATC 1 cut(s) 102
BstMAI GTCTC 2 cut(s) 24, 111
BstMBI GATC 1 cut(s) 99
BstNI CCWGG 1 cut(s) 36
BstNSI RCATGY 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 46
Bsu15I ATCGAT 1 cut(s) 131
BsuTUI ATCGAT 1 cut(s) 131
BtgI CCRYGG 1 cut(s) 214
BtsCI GGATG 1 cut(s) 229
Cfr13I GGNCC 1 cut(s) 136
ClaI ATCGAT 1 cut(s) 131
CviAII CATG 3 cut(s) 64, 86, 215
DdeI CTNAG 1 cut(s) 23
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
Eco130I CCWWGG 1 cut(s) 214
Eco47I GGWCC 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 214
ErhI CCWWGG 1 cut(s) 214
FaeI CATG 3 cut(s) 67, 89, 218
FaiI YATR 6 cut(s) 65, 87, 165, 185, 216, 262
FatI CATG 3 cut(s) 63, 85, 214
FokI GGATG 1 cut(s) 216
Hin1II CATG 3 cut(s) 67, 89, 218
HinfI GANTC 3 cut(s) 119, 145, 235
HphI GGTGA 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 3 cut(s) 24, 124, 234
Hpy8I GTNNAC 1 cut(s) 199
HpyCH4V TGCA 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 23
Hsp92II CATG 3 cut(s) 67, 89, 218
Kzo9I GATC 1 cut(s) 99
LpnPI CCDG 5 cut(s) 21, 48, 162, 215, 259
MaeIII GTNAC 1 cut(s) 220
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MboII GAAGA 2 cut(s) 3, 51
MluCI AATT 1 cut(s) 56
MlyI GAGTC 2 cut(s) 113, 229
MmeI TCCRAC 2 cut(s) 257, 263
MnlI CCTC 1 cut(s) 19
MspR9I CCNGG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 36
NcoI CCATGG 1 cut(s) 214
NdeII GATC 1 cut(s) 99
NlaIII CATG 3 cut(s) 67, 89, 218
NmuCI GTSAC 1 cut(s) 220
NspI RCATGY 1 cut(s) 67
PcsI WCGNNNNNNNCGW 1 cut(s) 128
PfeI GAWTC 1 cut(s) 145
PleI GAGTC 2 cut(s) 113, 229
PpsI GAGTC 2 cut(s) 113, 229
Psp6I CCWGG 1 cut(s) 34
PspGI CCWGG 1 cut(s) 34
PspPI GGNCC 1 cut(s) 136
Sau3AI GATC 1 cut(s) 99
Sau96I GGNCC 1 cut(s) 136
SchI GAGTC 2 cut(s) 113, 229
ScrFI CCNGG 1 cut(s) 36
SetI ASST 1 cut(s) 108
SinI GGWCC 1 cut(s) 136
Sse9I AATT 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 34
StyI CCWWGG 1 cut(s) 214
TaqI TCGA 1 cut(s) 131
TasI AATT 1 cut(s) 56
TfiI GAWTC 1 cut(s) 145
TseFI GTSAC 1 cut(s) 220
Tsp45I GTSAC 1 cut(s) 220
TspDTI ATGAA 1 cut(s) 102
VpaK11BI GGWCC 1 cut(s) 136
XceI RCATGY 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.