Rh4DG078000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
11566500 .. 11567045
546 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG078000.1

Sequence Viewer

Length: 234 bp
ATGAAAAGAAGACAACCAATAAGGAAATTGAGCATGTCATTCACCAACAAGAAACATGAAAATCCAAAGATCAAGGTCATTGATGGAGAATCGGAAACATCGATGGTCCAAGAGAATCCAGTTTCAAACAAATATGCAAGTATCAATAGTAATATAGACGATATTGTTTACCAGATTGATTACCATGGAGTGACTACTCATCCGACTCCAACACCCAGACACTCCAAACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.86

Weight (kDa)

9.57

Isoelectric Point (pI)

46.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017642)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g06540
malus_domestica MD16G1241400.v1.1
prunus_persica Prupe.1G068200_v2.0.a1
pyrus_communis pycom16g20230
rosa_chinensis RchiOBHm_Chr4g0398461
rosa_roxburghii Rroxscaffold_5G00343420
rosa_rugosa Rorug04G0008100
rosa_samantha Rh4AG086300 Rh4BG083200 Rh4CG094100 Rh4DG078000
rosa_wichuraiana Rw4G007220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 34
AvaII GGWCC 1 cut(s) 106
BbsI GAAGAC 1 cut(s) 16
BccI CCATC 2 cut(s) 77, 97
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 16
Bsa29I ATCGAT 1 cut(s) 101
BsaJI CCNNGG 1 cut(s) 184
Bse1I ACTGG 1 cut(s) 119
BseCI ATCGAT 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 1 cut(s) 199
BseNI ACTGG 1 cut(s) 119
BshVI ATCGAT 1 cut(s) 101
Bsp143I GATC 1 cut(s) 69
Bsp19I CCATGG 1 cut(s) 184
BspDI ATCGAT 1 cut(s) 101
BsrI ACTGG 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 184
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BstNSI RCATGY 1 cut(s) 37
BstV2I GAAGAC 1 cut(s) 16
Bsu15I ATCGAT 1 cut(s) 101
BsuTUI ATCGAT 1 cut(s) 101
BtgI CCRYGG 1 cut(s) 184
BtsCI GGATG 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 106
ClaI ATCGAT 1 cut(s) 101
CviAII CATG 3 cut(s) 34, 56, 185
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
Eco130I CCWWGG 1 cut(s) 184
Eco47I GGWCC 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 184
ErhI CCWWGG 1 cut(s) 184
FaeI CATG 3 cut(s) 37, 59, 188
FaiI YATR 6 cut(s) 35, 57, 135, 155, 186, 232
FatI CATG 3 cut(s) 33, 55, 184
FokI GGATG 1 cut(s) 186
Hin1II CATG 3 cut(s) 37, 59, 188
HinfI GANTC 3 cut(s) 89, 115, 205
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 2 cut(s) 94, 204
Hpy8I GTNNAC 1 cut(s) 169
HpyCH4V TGCA 1 cut(s) 137
Hsp92II CATG 3 cut(s) 37, 59, 188
Kzo9I GATC 1 cut(s) 69
LpnPI CCDG 3 cut(s) 132, 185, 229
MaeIII GTNAC 1 cut(s) 190
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 1 cut(s) 21
MluCI AATT 1 cut(s) 26
MlyI GAGTC 1 cut(s) 199
MmeI TCCRAC 2 cut(s) 227, 233
NcoI CCATGG 1 cut(s) 184
NdeII GATC 1 cut(s) 69
NlaIII CATG 3 cut(s) 37, 59, 188
NmuCI GTSAC 1 cut(s) 190
NspI RCATGY 1 cut(s) 37
PcsI WCGNNNNNNNCGW 1 cut(s) 98
PfeI GAWTC 2 cut(s) 89, 115
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
PspPI GGNCC 1 cut(s) 106
Sau3AI GATC 1 cut(s) 69
Sau96I GGNCC 1 cut(s) 106
SchI GAGTC 1 cut(s) 199
SetI ASST 1 cut(s) 78
SinI GGWCC 1 cut(s) 106
Sse9I AATT 1 cut(s) 26
StyI CCWWGG 1 cut(s) 184
TaqI TCGA 1 cut(s) 101
TasI AATT 1 cut(s) 26
TfiI GAWTC 2 cut(s) 89, 115
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 2 cut(s) 17, 72
VpaK11BI GGWCC 1 cut(s) 106
XceI RCATGY 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.