MD16G1241400.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Reverse (-)
26108666 .. 26110139
1474 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1241400.v1.1.491

Sequence Viewer

Length: 333 bp
ATGAAATCGGTGTACATCATTTTCTTATGCTTCCTTATAACAGTTCTCTGTCTTTCTTCCCACAAGATCAGTACCGATTCACGGACTTCTCTCCCAGGAAGACGACCCACGAGAAAATTAAGCATGTCATTGACCAACAACAAGGTTAATAAGTATCAAAAGTTCAAGGTCGTTGATGGAGACGGAGAGTCAGAAACATCGAAGTTCCGAGAAATTCCAGTAGTAATCAAACATTCAAACAGCAACAGTGATTTAGACGAGCTTGTTTATCACATCGATTATCATGGAGTGACTACTCATCCAAATCCAACACCTAGACATCCCACACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.51

Weight (kDa)

9.39

Isoelectric Point (pI)

37.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017642)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g06540
malus_domestica MD16G1241400.v1.1
prunus_persica Prupe.1G068200_v2.0.a1
pyrus_communis pycom16g20230
rosa_chinensis RchiOBHm_Chr4g0398461
rosa_roxburghii Rroxscaffold_5G00343420
rosa_rugosa Rorug04G0008100
rosa_samantha Rh4AG086300 Rh4BG083200 Rh4CG094100 Rh4DG078000
rosa_wichuraiana Rw4G007220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 38
AcsI RAATTY 1 cut(s) 213
AfaI GTAC 2 cut(s) 14, 73
AfiI CCNNNNNNNGG 1 cut(s) 81
AgsI TTSAA 2 cut(s) 166, 237
AhdI GACNNNNNGTC 1 cut(s) 187
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 262
AluI AGCT 1 cut(s) 262
Alw26I GTCTC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 213
BauI CACGAG 1 cut(s) 109
BbsI GAAGAC 1 cut(s) 106
BccI CCATC 1 cut(s) 170
BciT130I CCWGG 1 cut(s) 96
BcoDI GTCTC 1 cut(s) 174
BfaI CTAG 1 cut(s) 315
Bme1390I CCNGG 1 cut(s) 96
BmeRI GACNNNNNGTC 1 cut(s) 187
BmrFI CCNGG 1 cut(s) 96
BpiI GAAGAC 1 cut(s) 106
Bsa29I ATCGAT 1 cut(s) 276
BsaJI CCNNGG 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 81
Bse1I ACTGG 1 cut(s) 218
BseBI CCWGG 1 cut(s) 96
BseCI ATCGAT 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 2 cut(s) 298, 319
BseLI CCNNNNNNNGG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 218
BshVI ATCGAT 1 cut(s) 276
BslI CCNNNNNNNGG 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 174
BsmBI CGTCTC 1 cut(s) 174
Bsp1407I TGTACA 1 cut(s) 12
Bsp143I GATC 1 cut(s) 66
BspDI ATCGAT 1 cut(s) 276
BsrGI TGTACA 1 cut(s) 12
BsrI ACTGG 1 cut(s) 218
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 1 cut(s) 66
BssSI CACGAG 1 cut(s) 109
Bst2BI CACGAG 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 2 cut(s) 43, 248
BstAUI TGTACA 1 cut(s) 12
BstF5I GGATG 2 cut(s) 298, 319
BstKTI GATC 1 cut(s) 69
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 1 cut(s) 66
BstNI CCWGG 1 cut(s) 96
BstNSI RCATGY 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 106
Bsu15I ATCGAT 1 cut(s) 276
BsuTUI ATCGAT 1 cut(s) 276
BtsCI GGATG 2 cut(s) 298, 319
BtsIMutI CAGTG 1 cut(s) 253
ClaI ATCGAT 1 cut(s) 276
Csp6I GTAC 2 cut(s) 13, 72
CviAII CATG 2 cut(s) 124, 284
CviJI RGCY 1 cut(s) 262
CviKI_1 RGCY 1 cut(s) 262
CviQI GTAC 2 cut(s) 13, 72
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
DriI GACNNNNNGTC 1 cut(s) 187
Eam1105I GACNNNNNGTC 1 cut(s) 187
EcoRII CCWGG 1 cut(s) 94
Esp3I CGTCTC 1 cut(s) 174
FaeI CATG 2 cut(s) 127, 287
FaiI YATR 5 cut(s) 28, 38, 125, 285, 331
FatI CATG 2 cut(s) 123, 283
FokI GGATG 2 cut(s) 285, 306
FspBI CTAG 1 cut(s) 315
Hin1II CATG 2 cut(s) 127, 287
HinfI GANTC 2 cut(s) 77, 188
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 2 cut(s) 193, 209
Hpy8I GTNNAC 1 cut(s) 13
HpyCH4III ACNGT 2 cut(s) 43, 248
Hsp92II CATG 2 cut(s) 127, 287
Kzo9I GATC 1 cut(s) 66
LpnPI CCDG 3 cut(s) 81, 108, 231
MaeI CTAG 1 cut(s) 315
MaeIII GTNAC 1 cut(s) 289
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MboII GAAGA 2 cut(s) 48, 111
MluCI AATT 2 cut(s) 116, 213
MlyI GAGTC 1 cut(s) 197
MmeI TCCRAC 1 cut(s) 332
MseI TTAA 2 cut(s) 119, 147
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
NdeII GATC 1 cut(s) 66
NlaIII CATG 2 cut(s) 127, 287
NmuCI GTSAC 1 cut(s) 289
NspI RCATGY 1 cut(s) 127
PfeI GAWTC 1 cut(s) 77
PleI GAGTC 1 cut(s) 196
PpsI GAGTC 1 cut(s) 196
PsiI TTATAA 1 cut(s) 38
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PsrI GAACNNNNNNTAC 2 cut(s) 146, 178
RsaI GTAC 2 cut(s) 14, 73
RsaNI GTAC 2 cut(s) 13, 72
SaqAI TTAA 2 cut(s) 119, 147
Sau3AI GATC 1 cut(s) 66
SchI GAGTC 1 cut(s) 197
ScrFI CCNGG 1 cut(s) 96
SetI ASST 4 cut(s) 147, 171, 264, 316
Sse9I AATT 2 cut(s) 116, 213
SspMI CTAG 1 cut(s) 315
StyD4I CCNGG 1 cut(s) 94
TaaI ACNGT 2 cut(s) 43, 248
TaqI TCGA 2 cut(s) 200, 276
TasI AATT 2 cut(s) 116, 213
TatI WGTACW 1 cut(s) 12
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 2 cut(s) 119, 147
Tru9I TTAA 2 cut(s) 119, 147
TscAI CASTG 1 cut(s) 253
TseFI GTSAC 1 cut(s) 289
Tsp45I GTSAC 1 cut(s) 289
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 97, 198
TspRI CASTG 1 cut(s) 253
XapI RAATTY 1 cut(s) 213
XceI RCATGY 1 cut(s) 127
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.