FvH4_5g35200

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
25759993 .. 25761043
1051 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g35200.t1

Sequence Viewer

Length: 366 bp
ATGGCGTTAACGGTGTCAAAGTTGAACAAGATGATGTACAAGCAGGATATTTTTCATCAAGCCCTCTTAGGGTTGATTGTAGGTGCAATTTTCAGCTCTTGCTTCCATGGGTTTCACCTGAATTTGGAGGAACAACTTAACAGAAGCCATTTTACACAAACCATGGTTGAATTACAATTCAATGTCTCAAGAAGCATGCAAGATGGCTTGATCACTTTGGTAATAAAATTCCACCATTTCTTCATCTCAAAGTGTCTACAGTACCGATACTCCTCCCTTTTAGGGAAACCATCTTTTGAAACGTCAATGCTATTTTGGGTAGCACTCGCACGATCAGTTTCTTCCATGTCCGACTCCTCTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.89

Weight (kDa)

9.06

Isoelectric Point (pI)

49.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017918)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G58225 AT1G58225
fragaria_vesca FvH4_5g35200
prunus_persica Prupe.1G533500_v2.0.a1
pyrus_communis pycom15g34730
rosa_roxburghii Rroxscaffold_3G00225240 Rroxscaffold_3G00225250
rosa_rugosa Rorug07G0295400 Rorug07G0295400
rosa_samantha Rh7DG439700
rosa_wichuraiana Rw7G037460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 256
AcsI RAATTY 2 cut(s) 121, 227
AfaI GTAC 2 cut(s) 38, 263
AfiI CCNNNNNNNGG 3 cut(s) 69, 124, 282
AgsI TTSAA 4 cut(s) 25, 170, 181, 299
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 190
ApoI RAATTY 2 cut(s) 121, 227
AsuHPI GGTGA 1 cut(s) 107
BarI GAAGNNNNNNTAC 2 cut(s) 136, 168
BccI CCATC 2 cut(s) 197, 298
BclI TGATCA 1 cut(s) 210
BcoDI GTCTC 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 257
BpuEI CTTGAG 1 cut(s) 172
BsaJI CCNNGG 2 cut(s) 106, 162
BsaXI ACNNNNNCTCC 2 cut(s) 254, 284
Bsc4I CCNNNNNNNGG 3 cut(s) 69, 124, 282
BseDI CCNNGG 2 cut(s) 106, 162
BseLI CCNNNNNNNGG 3 cut(s) 69, 124, 282
BseRI GAGGAG 2 cut(s) 262, 346
BslI CCNNNNNNNGG 3 cut(s) 69, 124, 282
BsmAI GTCTC 1 cut(s) 190
Bsp1407I TGTACA 1 cut(s) 36
Bsp143I GATC 2 cut(s) 210, 332
Bsp19I CCATGG 2 cut(s) 106, 162
BsrGI TGTACA 1 cut(s) 36
BssECI CCNNGG 2 cut(s) 106, 162
BssMI GATC 2 cut(s) 210, 332
BssT1I CCWWGG 2 cut(s) 106, 162
Bst4CI ACNGT 2 cut(s) 13, 261
BstAUI TGTACA 1 cut(s) 36
BstC8I GCNNGC 1 cut(s) 197
BstDEI CTNAG 1 cut(s) 67
BstDSI CCRYGG 2 cut(s) 106, 162
BstKTI GATC 2 cut(s) 213, 335
BstMAI GTCTC 1 cut(s) 190
BstMBI GATC 2 cut(s) 210, 332
BstNSI RCATGY 1 cut(s) 199
BstSFI CTRYAG 1 cut(s) 257
BtgI CCRYGG 2 cut(s) 106, 162
Cac8I GCNNGC 1 cut(s) 197
Csp6I GTAC 2 cut(s) 37, 262
CviAII CATG 4 cut(s) 107, 163, 196, 346
CviJI RGCY 4 cut(s) 62, 96, 147, 207
CviKI_1 RGCY 4 cut(s) 62, 96, 147, 207
CviQI GTAC 2 cut(s) 37, 262
DdeI CTNAG 1 cut(s) 67
DpnI GATC 2 cut(s) 212, 334
DpnII GATC 2 cut(s) 210, 332
Eco130I CCWWGG 2 cut(s) 106, 162
EcoT14I CCWWGG 2 cut(s) 106, 162
ErhI CCWWGG 2 cut(s) 106, 162
FaeI CATG 4 cut(s) 110, 166, 199, 349
FaiI YATR 4 cut(s) 108, 164, 197, 347
FatI CATG 4 cut(s) 106, 162, 195, 345
FbaI TGATCA 1 cut(s) 210
FblI GTMKAC 1 cut(s) 256
Hin1II CATG 4 cut(s) 110, 166, 199, 349
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HinfI GANTC 1 cut(s) 353
HpaI GTTAAC 1 cut(s) 9
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 2 cut(s) 9, 257
Hpy188I TCNGA 1 cut(s) 352
Hpy188III TCNNGA 1 cut(s) 189
Hpy8I GTNNAC 2 cut(s) 9, 257
HpyCH4III ACNGT 2 cut(s) 13, 261
HpyCH4IV ACGT 1 cut(s) 302
HpyCH4V TGCA 2 cut(s) 86, 199
HpyF3I CTNAG 1 cut(s) 67
HpySE526I ACGT 1 cut(s) 302
Hsp92II CATG 4 cut(s) 110, 166, 199, 349
Ksp22I TGATCA 1 cut(s) 210
KspAI GTTAAC 1 cut(s) 9
Kzo9I GATC 2 cut(s) 210, 332
LpnPI CCDG 2 cut(s) 29, 131
MaeII ACGT 1 cut(s) 302
MalI GATC 2 cut(s) 212, 334
MboI GATC 2 cut(s) 210, 332
MboII GAAGA 2 cut(s) 232, 333
MluCI AATT 5 cut(s) 87, 121, 170, 176, 227
MlyI GAGTC 1 cut(s) 347
MnlI CCTC 3 cut(s) 74, 121, 283
MseI TTAA 2 cut(s) 8, 138
NcoI CCATGG 2 cut(s) 106, 162
NdeII GATC 2 cut(s) 210, 332
NlaIII CATG 4 cut(s) 110, 166, 199, 349
NspI RCATGY 1 cut(s) 199
PaeI GCATGC 1 cut(s) 199
PleI GAGTC 1 cut(s) 347
PpsI GAGTC 1 cut(s) 347
RsaI GTAC 2 cut(s) 38, 263
RsaNI GTAC 2 cut(s) 37, 262
SaqAI TTAA 2 cut(s) 8, 138
Sau3AI GATC 2 cut(s) 210, 332
SchI GAGTC 1 cut(s) 347
SetI ASST 4 cut(s) 85, 98, 120, 305
SfcI CTRYAG 1 cut(s) 257
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
SphI GCATGC 1 cut(s) 199
Sse9I AATT 5 cut(s) 87, 121, 170, 176, 227
StyI CCWWGG 2 cut(s) 106, 162
TaaI ACNGT 2 cut(s) 13, 261
TaiI ACGT 1 cut(s) 305
TasI AATT 5 cut(s) 87, 121, 170, 176, 227
TatI WGTACW 1 cut(s) 36
Tru1I TTAA 2 cut(s) 8, 138
Tru9I TTAA 2 cut(s) 8, 138
TspDTI ATGAA 2 cut(s) 44, 232
XapI RAATTY 2 cut(s) 121, 227
XceI RCATGY 1 cut(s) 199
XmiI GTMKAC 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.