Rw7G037460

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
56855849 .. 56856374
526 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G037460.1

Sequence Viewer

Length: 357 bp
ATGGTGTCAAAGTTAAACAAGAGGATGAACAAGCAGGATATTTATCTTCAGGCCCTATTAGGGTTGTTTGTAGGTGCTATTTTCAGCTCTTGTTTTCACGGGTTTCAACTGAATATGGAGGAACAACTTAACAGAAACCATTTTACACAAAGCATGGTTGAATTACACGGCAACGTCGCAAGAAGCATGCAAGATGGCTTGATCACTCTCGTAATTAAATTCCTCCATTTCTTCATCTCAAGGTGTCTACAGTTCCGATATTCGTCCCCTCTGGGAACACCATCTTATGCAACATCAATGCTATTTTGGGTAGCACTTACTCGATCAGTTTCTACCATGTCCGACTCCTCTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.48

Weight (kDa)

9.44

Isoelectric Point (pI)

56.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017918)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G58225 AT1G58225
fragaria_vesca FvH4_5g35200
prunus_persica Prupe.1G533500_v2.0.a1
pyrus_communis pycom15g34730
rosa_roxburghii Rroxscaffold_3G00225240 Rroxscaffold_3G00225250
rosa_rugosa Rorug07G0295400 Rorug07G0295400
rosa_samantha Rh7DG439700
rosa_wichuraiana Rw7G037460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 247
AcsI RAATTY 1 cut(s) 218
AcuI CTGAAG 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 60
AgsI TTSAA 2 cut(s) 107, 161
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
AoxI GGCC 1 cut(s) 51
ApoI RAATTY 1 cut(s) 218
AspS9I GGNCC 1 cut(s) 52
BccI CCATC 2 cut(s) 188, 289
BceAI ACGGC 1 cut(s) 184
BclI TGATCA 1 cut(s) 201
BfmI CTRYAG 1 cut(s) 248
BmgT120I GGNCC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 223
BsaBI GATNNNNATC 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 60
Bse8I GATNNNNATC 1 cut(s) 42
BseGI GGATG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 60
BseRI GAGGAG 1 cut(s) 337
BshFI GGCC 1 cut(s) 53
BslFI GGGAC 1 cut(s) 250
BslI CCNNNNNNNGG 1 cut(s) 60
BsmFI GGGAC 1 cut(s) 250
BsnI GGCC 1 cut(s) 53
Bsp143I GATC 2 cut(s) 201, 323
BspANI GGCC 1 cut(s) 53
BssMI GATC 2 cut(s) 201, 323
Bst4CI ACNGT 1 cut(s) 252
BstC8I GCNNGC 1 cut(s) 188
BstF5I GGATG 1 cut(s) 30
BstKTI GATC 2 cut(s) 204, 326
BstMBI GATC 2 cut(s) 201, 323
BstNSI RCATGY 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 248
BsuRI GGCC 1 cut(s) 53
BtsCI GGATG 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 52
CviAII CATG 3 cut(s) 154, 187, 337
CviJI RGCY 3 cut(s) 53, 87, 198
CviKI_1 RGCY 3 cut(s) 53, 87, 198
DpnI GATC 2 cut(s) 203, 325
DpnII GATC 2 cut(s) 201, 323
Eco57I CTGAAG 1 cut(s) 32
EcoO109I RGGNCCY 1 cut(s) 52
FaeI CATG 3 cut(s) 157, 190, 340
FaiI YATR 5 cut(s) 116, 155, 188, 288, 338
FaqI GGGAC 1 cut(s) 250
FatI CATG 3 cut(s) 153, 186, 336
FbaI TGATCA 1 cut(s) 201
FblI GTMKAC 1 cut(s) 247
FokI GGATG 1 cut(s) 37
HaeIII GGCC 1 cut(s) 53
Hin1II CATG 3 cut(s) 157, 190, 340
HinfI GANTC 1 cut(s) 344
Hpy166II GTNNAC 1 cut(s) 248
Hpy188I TCNGA 2 cut(s) 257, 343
Hpy8I GTNNAC 1 cut(s) 248
Hpy99I CGWCG 1 cut(s) 179
HpyCH4III ACNGT 1 cut(s) 252
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 2 cut(s) 190, 290
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 3 cut(s) 157, 190, 340
Ksp22I TGATCA 1 cut(s) 201
Kzo9I GATC 2 cut(s) 201, 323
LpnPI CCDG 3 cut(s) 20, 35, 257
MaeII ACGT 1 cut(s) 174
MalI GATC 2 cut(s) 203, 325
MboI GATC 2 cut(s) 201, 323
MboII GAAGA 2 cut(s) 38, 223
MluCI AATT 3 cut(s) 161, 213, 218
MlyI GAGTC 1 cut(s) 338
MnlI CCTC 4 cut(s) 15, 112, 233, 279
MseI TTAA 3 cut(s) 14, 129, 216
NdeII GATC 2 cut(s) 201, 323
NlaIII CATG 3 cut(s) 157, 190, 340
NspI RCATGY 1 cut(s) 190
PaeI GCATGC 1 cut(s) 190
PleI GAGTC 1 cut(s) 338
PpsI GAGTC 1 cut(s) 338
PspPI GGNCC 1 cut(s) 52
SaqAI TTAA 3 cut(s) 14, 129, 216
Sau3AI GATC 2 cut(s) 201, 323
Sau96I GGNCC 1 cut(s) 52
SchI GAGTC 1 cut(s) 338
SetI ASST 4 cut(s) 76, 89, 177, 245
SfcI CTRYAG 1 cut(s) 248
SmlI CTYRAG 1 cut(s) 238
SmoI CTYRAG 1 cut(s) 238
SphI GCATGC 1 cut(s) 190
Sse9I AATT 3 cut(s) 161, 213, 218
TaaI ACNGT 1 cut(s) 252
TaiI ACGT 1 cut(s) 177
TaqI TCGA 1 cut(s) 322
TasI AATT 3 cut(s) 161, 213, 218
Tru1I TTAA 3 cut(s) 14, 129, 216
Tru9I TTAA 3 cut(s) 14, 129, 216
TspDTI ATGAA 2 cut(s) 41, 223
XapI RAATTY 1 cut(s) 218
XceI RCATGY 1 cut(s) 190
XmiI GTMKAC 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.