Rh7DG439700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
62534512 .. 62535228
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG439700.1

Sequence Viewer

Length: 255 bp
ATGATGAACAAGCAGGATATTTATCTTCAGGCCCTATTAGGGTTGTTTGTAGGTGCTATTTTCAGCTCTTGTTTTCACGGGTTTCAACTGAATATGGAGGAGCAACTTAACAGAAGCCATTTTACACAAAGCATGGACATCTGCCAAGGGAACACCTTTAGCTTACGCTCTAAATTGCAAAATCATGAAAACACAAACCCATATCCGCTAGAACAATTCCAGAGGCATGAAGAGAAAAAAGGTATGGCGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.83

Weight (kDa)

6.89

Isoelectric Point (pI)

54.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017918)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G58225 AT1G58225
fragaria_vesca FvH4_5g35200
prunus_persica Prupe.1G533500_v2.0.a1
pyrus_communis pycom15g34730
rosa_roxburghii Rroxscaffold_3G00225240 Rroxscaffold_3G00225250
rosa_rugosa Rorug07G0295400 Rorug07G0295400
rosa_samantha Rh7DG439700
rosa_wichuraiana Rw7G037460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 206
AcuI CTGAAG 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 39
AgsI TTSAA 1 cut(s) 86
AluBI AGCT 2 cut(s) 66, 162
AluI AGCT 2 cut(s) 66, 162
AoxI GGCC 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 31
BarI GAAGNNNNNNTAC 2 cut(s) 106, 138
BfaI CTAG 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 31
BsaBI GATNNNNATC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 39
Bse8I GATNNNNATC 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 145
BseJI GATNNNNATC 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 39
BseRI GAGGAG 1 cut(s) 113
BshFI GGCC 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 39
BsnI GGCC 1 cut(s) 32
BspACI CCGC 1 cut(s) 206
BspANI GGCC 1 cut(s) 32
BspHI TCATGA 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 145
BssT1I CCWWGG 1 cut(s) 145
Bst6I CTCTTC 1 cut(s) 225
BsuRI GGCC 1 cut(s) 32
CciI TCATGA 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 31
CviAII CATG 3 cut(s) 133, 185, 227
CviJI RGCY 4 cut(s) 32, 66, 117, 162
CviKI_1 RGCY 4 cut(s) 32, 66, 117, 162
Eam1104I CTCTTC 1 cut(s) 225
EarI CTCTTC 1 cut(s) 225
Eco130I CCWWGG 1 cut(s) 145
Eco57I CTGAAG 1 cut(s) 11
EcoO109I RGGNCCY 1 cut(s) 31
EcoT14I CCWWGG 1 cut(s) 145
ErhI CCWWGG 1 cut(s) 145
FaeI CATG 3 cut(s) 136, 188, 230
FaiI YATR 6 cut(s) 95, 134, 186, 202, 228, 245
FatI CATG 3 cut(s) 132, 184, 226
FspBI CTAG 1 cut(s) 209
HaeIII GGCC 1 cut(s) 32
Hin1II CATG 3 cut(s) 136, 188, 230
Hpy188III TCNNGA 2 cut(s) 185, 220
HpyCH4V TGCA 1 cut(s) 178
Hsp92II CATG 3 cut(s) 136, 188, 230
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 2 cut(s) 14, 233
MaeI CTAG 1 cut(s) 209
MboII GAAGA 2 cut(s) 17, 242
MluCI AATT 2 cut(s) 173, 215
MnlI CCTC 2 cut(s) 91, 216
MseI TTAA 1 cut(s) 108
NlaIII CATG 3 cut(s) 136, 188, 230
PagI TCATGA 1 cut(s) 184
PspPI GGNCC 1 cut(s) 31
SaqAI TTAA 1 cut(s) 108
Sau96I GGNCC 1 cut(s) 31
SetI ASST 5 cut(s) 55, 68, 158, 164, 244
Sse9I AATT 2 cut(s) 173, 215
SsiI CCGC 1 cut(s) 206
SspMI CTAG 1 cut(s) 209
StyI CCWWGG 1 cut(s) 145
TasI AATT 2 cut(s) 173, 215
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TspDTI ATGAA 3 cut(s) 20, 201, 243
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.