FvH4_5g39761

Zinc knuckle family protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0019242
Physical Location & Seq
Forward (+)
29402117 .. 29403226
1110 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g39761.t1

Sequence Viewer

Length: 474 bp
ATGAGAATTTCTGATGCTGTTAATACCTTATTTTACACAATCATCCAACATTTCATAGGGACCCCTAGTCATATTACATCCAGAATTCATGATCAACTTAGTAACTTTAGGTGTCCTACCTTAAGTGATTTCAAATGGTACAAAAATGTCTTTATCTCTCGAGTCATGCTTAGAGACGATAGTAACCAACCATTTTGGAAAGAAAAATCCATAAATGGTCTTCCAAAGTTATTTGCTCATAAAATCAGACAAGTCCTTAGTAATGAAACATGTCATATTAATTACGATTCTTTAACTTATGGAAATATAATTACAGTTATCCAAAAAGAAGGATTAAAAATGTGTATAGATATGAAACTAAATGCTCAAATGAAATCAGATAAGAAAACAGCTAAATACGAACTAGGAAACTTTTGTGAACAATATGGCTTACCTTCTTTACCTCCTTCAAGAAGAAAAAAAAGCAAGCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MP RVP zf-CCHC

Protein Analysis

158

Amino Acids

18.32

Weight (kDa)

9.64

Isoelectric Point (pI)

41.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Caulimovir_coat_dom PF22909 30 - 129 2.8e-11 Caulimovirus coat protein, conserved domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019242)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g39761
prunus_persica Prupe.4G270900_v2.0.a1
pyrus_communis pycom01g03940 pycom03g01680 pycom13g24850
rosa_multiflora Rmu_sc0000235.1_g000028 Rmu_sc0000365.1_g000044 Rmu_sc0006558.1_g000026

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 6, 84
AfaI GTAC 1 cut(s) 140
AflII CTTAAG 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 269
AgsI TTSAA 2 cut(s) 133, 450
AhdI GACNNNNNGTC 1 cut(s) 66
AluBI AGCT 1 cut(s) 392
AluI AGCT 1 cut(s) 392
Alw26I GTCTC 1 cut(s) 168
Ama87I CYCGRG 1 cut(s) 159
ApoI RAATTY 2 cut(s) 6, 84
AseI ATTAAT 1 cut(s) 279
AspS9I GGNCC 1 cut(s) 60
AvaI CYCGRG 1 cut(s) 159
AvaII GGWCC 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 212
BclI TGATCA 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 168
BfaI CTAG 2 cut(s) 66, 404
BfrI CTTAAG 1 cut(s) 121
Bme18I GGWCC 1 cut(s) 60
BmeRI GACNNNNNGTC 1 cut(s) 66
BmeT110I CYCGRG 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 60
BmiI GGNNCC 2 cut(s) 61, 62
BmsI GCATC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 212
BseGI GGATG 2 cut(s) 42, 77
BsiHKCI CYCGRG 1 cut(s) 159
BslFI GGGAC 1 cut(s) 73
BsmAI GTCTC 1 cut(s) 168
BsmBI CGTCTC 1 cut(s) 168
BsmFI GGGAC 1 cut(s) 73
BsoBI CYCGRG 1 cut(s) 159
Bsp143I GATC 1 cut(s) 91
BspHI TCATGA 1 cut(s) 88
BspLI GGNNCC 2 cut(s) 61, 62
BspTI CTTAAG 1 cut(s) 121
BssMI GATC 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 316
BstAFI CTTAAG 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 467
BstDEI CTNAG 3 cut(s) 98, 170, 257
BstF5I GGATG 2 cut(s) 42, 77
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 168
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 273
BstV2I GAAGAC 1 cut(s) 212
BtsCI GGATG 2 cut(s) 42, 77
Cac8I GCNNGC 1 cut(s) 467
CciI TCATGA 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 139
CviAII CATG 3 cut(s) 89, 166, 270
CviJI RGCY 2 cut(s) 392, 429
CviKI_1 RGCY 2 cut(s) 392, 429
CviQI GTAC 1 cut(s) 139
DdeI CTNAG 3 cut(s) 98, 170, 257
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DriI GACNNNNNGTC 1 cut(s) 66
Eam1105I GACNNNNNGTC 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 60
Eco88I CYCGRG 1 cut(s) 159
EcoO109I RGGNCCY 1 cut(s) 60
EcoRI GAATTC 1 cut(s) 84
Esp3I CGTCTC 1 cut(s) 168
FaeI CATG 3 cut(s) 92, 169, 273
FaqI GGGAC 1 cut(s) 73
FatI CATG 3 cut(s) 88, 165, 269
FbaI TGATCA 1 cut(s) 91
FokI GGATG 2 cut(s) 29, 64
FspBI CTAG 2 cut(s) 66, 404
Hin1II CATG 3 cut(s) 92, 169, 273
HinfI GANTC 2 cut(s) 162, 287
Hpy166II GTNNAC 1 cut(s) 419
Hpy188I TCNGA 3 cut(s) 13, 248, 379
Hpy188III TCNNGA 4 cut(s) 81, 89, 159, 450
Hpy8I GTNNAC 1 cut(s) 419
HpyAV CCTTC 3 cut(s) 323, 444, 456
HpyCH4III ACNGT 1 cut(s) 316
HpyF3I CTNAG 3 cut(s) 98, 170, 257
Hsp92II CATG 3 cut(s) 92, 169, 273
KflI GGGWCCC 1 cut(s) 60
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 1 cut(s) 94
LweI GCATC 1 cut(s) 4
MaeI CTAG 2 cut(s) 66, 404
MaeIII GTNAC 2 cut(s) 101, 182
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 2 cut(s) 212, 465
MluCI AATT 4 cut(s) 6, 84, 280, 309
MlyI GAGTC 1 cut(s) 171
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 1 cut(s) 453
MseI TTAA 5 cut(s) 21, 122, 279, 293, 335
MspCI CTTAAG 1 cut(s) 121
NdeII GATC 1 cut(s) 91
NlaIII CATG 3 cut(s) 92, 169, 273
NlaIV GGNNCC 2 cut(s) 61, 62
NspI RCATGY 1 cut(s) 273
PaeR7I CTCGAG 1 cut(s) 159
PagI TCATGA 1 cut(s) 88
PciI ACATGT 1 cut(s) 269
PfeI GAWTC 1 cut(s) 287
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
PpuMI RGGWCCY 1 cut(s) 60
PscI ACATGT 1 cut(s) 269
PshBI ATTAAT 1 cut(s) 279
Psp5II RGGWCCY 1 cut(s) 60
PspN4I GGNNCC 2 cut(s) 61, 62
PspPI GGNCC 1 cut(s) 60
PspPPI RGGWCCY 1 cut(s) 60
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
SaqAI TTAA 5 cut(s) 21, 122, 279, 293, 335
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 60
SchI GAGTC 1 cut(s) 171
SetI ASST 6 cut(s) 29, 113, 122, 394, 436, 445
SfaNI GCATC 1 cut(s) 4
Sfr274I CTCGAG 1 cut(s) 159
SinI GGWCC 1 cut(s) 60
SlaI CTCGAG 1 cut(s) 159
SmlI CTYRAG 2 cut(s) 121, 159
SmoI CTYRAG 2 cut(s) 121, 159
Sse9I AATT 4 cut(s) 6, 84, 280, 309
SspMI CTAG 2 cut(s) 66, 404
TaaI ACNGT 1 cut(s) 316
TaqI TCGA 1 cut(s) 160
TasI AATT 4 cut(s) 6, 84, 280, 309
TfiI GAWTC 1 cut(s) 287
Tru1I TTAA 5 cut(s) 21, 122, 279, 293, 335
Tru9I TTAA 5 cut(s) 21, 122, 279, 293, 335
TspDTI ATGAA 5 cut(s) 43, 77, 279, 368, 386
Vha464I CTTAAG 1 cut(s) 121
VpaK11BI GGWCC 1 cut(s) 60
VspI ATTAAT 1 cut(s) 279
XapI RAATTY 2 cut(s) 6, 84
XceI RCATGY 1 cut(s) 273
XhoI CTCGAG 1 cut(s) 159
XspI CTAG 2 cut(s) 66, 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.