Rmu_sc0000235.1_g000028

Zinc knuckle family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000235.1
Physical Location & Seq
Forward (+)
76642 .. 77058
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000235.1_g000028.1.cds

Sequence Viewer

Length: 417 bp
atgctcaaagaactcaaagctgaacccaatagaattgcagtcatccatgcccacgaatcctcttccgactcctcctcctccggtagtgattctgatacaatttcccaaatcaatcaaacatttcatgaactccaattacatagaatcgttcatccaaagaaacggcctttccgaaattggacagaacgccctttaccattagatattcaacccactacttatcccagtaatcaattttcagtctcttccgataaaacctatgaatggaacattgataatttatccgaacaggaaatcttaaataaattacatcacatgtccatggcagccaatagttacgtcactaatcataatttcaaccagcctgaaattattgatattctctccacaggattcacaggaatgcttcattcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.8

Weight (kDa)

5.94

Isoelectric Point (pI)

52.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019242)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 264
AflIII ACRYGT 1 cut(s) 315
AgsI TTSAA 2 cut(s) 209, 358
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
Alw26I GTCTC 1 cut(s) 247
AoxI GGCC 1 cut(s) 164
ApeKI GCWGC 1 cut(s) 326
BbvI GCAGC 1 cut(s) 338
BceAI ACGGC 1 cut(s) 179
BcoDI GTCTC 1 cut(s) 247
BfaI CTAG 1 cut(s) 415
BisI GCNGC 1 cut(s) 327
BlsI GCNGC 1 cut(s) 328
BmrI ACTGGG 1 cut(s) 219
BmuI ACTGGG 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 321
BsaWI WCCGGW 1 cut(s) 80
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
Bsc4I CCNNNNNNNGG 1 cut(s) 264
Bse1I ACTGG 1 cut(s) 225
BseDI CCNNGG 1 cut(s) 321
BseGI GGATG 2 cut(s) 42, 151
BseLI CCNNNNNNNGG 1 cut(s) 264
BseNI ACTGG 1 cut(s) 225
BseRI GAGGAG 3 cut(s) 61, 64, 67
BseXI GCAGC 1 cut(s) 338
BshFI GGCC 1 cut(s) 166
BsiSI CCGG 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 264
BsmAI GTCTC 1 cut(s) 247
BsmI GAATGC 1 cut(s) 408
BsnI GGCC 1 cut(s) 166
Bsp19I CCATGG 1 cut(s) 321
BspANI GGCC 1 cut(s) 166
BspHI TCATGA 1 cut(s) 124
BsrI ACTGG 1 cut(s) 225
BssECI CCNNGG 1 cut(s) 321
BssT1I CCWWGG 1 cut(s) 321
Bst6I CTCTTC 2 cut(s) 67, 250
BstDSI CCRYGG 1 cut(s) 321
BstF5I GGATG 2 cut(s) 42, 151
BstMAI GTCTC 1 cut(s) 247
BstNSI RCATGY 1 cut(s) 319
BstV1I GCAGC 1 cut(s) 338
BsuRI GGCC 1 cut(s) 166
BtgI CCRYGG 1 cut(s) 321
BtsCI GGATG 2 cut(s) 42, 151
CciI TCATGA 1 cut(s) 124
CviAII CATG 4 cut(s) 47, 125, 316, 322
CviJI RGCY 4 cut(s) 20, 166, 329, 364
CviKI_1 RGCY 4 cut(s) 20, 166, 329, 364
Eam1104I CTCTTC 2 cut(s) 67, 250
EarI CTCTTC 2 cut(s) 67, 250
Eco130I CCWWGG 1 cut(s) 321
EcoT14I CCWWGG 1 cut(s) 321
ErhI CCWWGG 1 cut(s) 321
FaeI CATG 4 cut(s) 50, 128, 319, 325
FaiI YATR 7 cut(s) 48, 126, 141, 261, 317, 323, 351
FatI CATG 4 cut(s) 46, 124, 315, 321
Fnu4HI GCNGC 1 cut(s) 327
FokI GGATG 2 cut(s) 29, 138
Fsp4HI GCNGC 1 cut(s) 327
FspBI CTAG 1 cut(s) 415
GluI GCNGC 1 cut(s) 327
HaeIII GGCC 1 cut(s) 166
HapII CCGG 1 cut(s) 81
Hin1II CATG 4 cut(s) 50, 128, 319, 325
HinfI GANTC 5 cut(s) 56, 68, 89, 144, 393
HpaII CCGG 1 cut(s) 81
Hpy188I TCNGA 5 cut(s) 67, 94, 173, 250, 286
Hpy188III TCNNGA 1 cut(s) 125
HpyCH4IV ACGT 1 cut(s) 339
HpyCH4V TGCA 1 cut(s) 38
HpySE526I ACGT 1 cut(s) 339
Hsp92II CATG 4 cut(s) 50, 128, 319, 325
LpnPI CCDG 7 cut(s) 94, 238, 275, 374, 375, 378, 384
Lsp1109I GCAGC 1 cut(s) 338
MaeI CTAG 1 cut(s) 415
MaeII ACGT 1 cut(s) 339
MaeIII GTNAC 2 cut(s) 335, 340
MboII GAAGA 2 cut(s) 54, 237
MluCI AATT 9 cut(s) 33, 99, 134, 175, 233, 277, 305, 352, 369
MlyI GAGTC 1 cut(s) 62
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 4 cut(s) 70, 82, 85, 88
MseI TTAA 1 cut(s) 299
MslI CAYNNNNRTG 2 cut(s) 320, 401
MspI CCGG 1 cut(s) 81
Mva1269I GAATGC 1 cut(s) 408
NcoI CCATGG 1 cut(s) 321
NlaIII CATG 4 cut(s) 50, 128, 319, 325
NmuCI GTSAC 1 cut(s) 340
NspI RCATGY 1 cut(s) 319
PagI TCATGA 1 cut(s) 124
PciI ACATGT 1 cut(s) 315
PcsI WCGNNNNNNNCGW 1 cut(s) 169
PctI GAATGC 1 cut(s) 408
PfeI GAWTC 4 cut(s) 56, 89, 144, 393
PkrI GCNGC 1 cut(s) 328
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
PscI ACATGT 1 cut(s) 315
PsrI GAACNNNNNNTAC 4 cut(s) 120, 152, 177, 209
RseI CAYNNNNRTG 2 cut(s) 320, 401
SaqAI TTAA 1 cut(s) 299
SatI GCNGC 1 cut(s) 327
SchI GAGTC 1 cut(s) 62
SetI ASST 3 cut(s) 22, 260, 342
SmiMI CAYNNNNRTG 2 cut(s) 320, 401
Sse9I AATT 9 cut(s) 33, 99, 134, 175, 233, 277, 305, 352, 369
SspMI CTAG 1 cut(s) 415
StyI CCWWGG 1 cut(s) 321
TaiI ACGT 1 cut(s) 342
TasI AATT 9 cut(s) 33, 99, 134, 175, 233, 277, 305, 352, 369
TfiI GAWTC 4 cut(s) 56, 89, 144, 393
Tru1I TTAA 1 cut(s) 299
Tru9I TTAA 1 cut(s) 299
TseFI GTSAC 1 cut(s) 340
TseI GCWGC 1 cut(s) 326
Tsp45I GTSAC 1 cut(s) 340
TspDTI ATGAA 5 cut(s) 113, 140, 141, 276, 398
XceI RCATGY 1 cut(s) 319
XspI CTAG 1 cut(s) 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.