MD00G1173200.v1.1

Belongs to the MIP aquaporin (TC 1.A.8) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0019775
Physical Location & Seq
Forward (+)
39985853 .. 39986189
337 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1173200.v1.1.491

Sequence Viewer

Length: 243 bp
ATGCAGATCTTGGCCCCTCTTCCCATTGGTTTTGCAGTGTTCTTGGTTCACTTGGCCACCATCTCCATCACGGGAACTGGCATCAACCTAGCCAGGAGTCTTGGAGCCGCCATTGTCTACAACAAGGACCGCGCTTGGGATTACCACTGGATCTTCTGGGTTGGACCATTCATTGGTGCTGCTCTTGTGGTCATCGGGCCATTCCCTTCAAGTCCAGGGGCTAATTTTCTTCCAGAGCTATAG

Protein Analysis

81

Amino Acids

8.59

Weight (kDa)

6.7

Isoelectric Point (pI)

33.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MIP PF00230 4 - 63 1.3e-22 Major intrinsic protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019775)

Species Orthologous Gene IDs
malus_domestica MD00G1173200.v1.1 MD07G1136400.v1.1
pyrus_communis pycom07g13370
rosa_chinensis RchiOBHm_Chr2g0098661
rosa_multiflora Rmu_co8012854.1_g000001
rosa_samantha Rh2AG121800 Rh2CG126400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 173
AccI GTMKAC 1 cut(s) 117
AccII CGCG 1 cut(s) 132
AciI CCGC 2 cut(s) 108, 130
AclWI GGATC 1 cut(s) 158
AcoI YGGCCR 1 cut(s) 54
AfiI CCNNNNNNNGG 2 cut(s) 136, 173
AgsI TTSAA 1 cut(s) 210
AjnI CCWGG 2 cut(s) 92, 214
AluBI AGCT 1 cut(s) 238
AluI AGCT 1 cut(s) 238
AlwI GGATC 1 cut(s) 158
AoxI GGCC 3 cut(s) 12, 54, 197
ApeKI GCWGC 1 cut(s) 179
AspLEI GCGC 1 cut(s) 134
AspS9I GGNCC 4 cut(s) 13, 127, 164, 197
AvaII GGWCC 2 cut(s) 127, 164
BalI TGGCCA 1 cut(s) 56
BbvI GCAGC 1 cut(s) 166
BccI CCATC 2 cut(s) 68, 74
BciT130I CCWGG 2 cut(s) 94, 216
BfaI CTAG 1 cut(s) 89
BfmI CTRYAG 1 cut(s) 239
BglII AGATCT 1 cut(s) 6
BisI GCNGC 2 cut(s) 108, 180
BlsI GCNGC 2 cut(s) 109, 181
Bme1390I CCNGG 2 cut(s) 94, 216
Bme18I GGWCC 2 cut(s) 127, 164
BmgT120I GGNCC 4 cut(s) 13, 127, 164, 197
BmiI GGNNCC 2 cut(s) 15, 106
BmrFI CCNGG 2 cut(s) 94, 216
BmsI GCATC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 215
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 173
Bse1I ACTGG 2 cut(s) 82, 152
BseBI CCWGG 2 cut(s) 94, 216
BseDI CCNNGG 1 cut(s) 215
BseLI CCNNNNNNNGG 2 cut(s) 136, 173
BseNI ACTGG 2 cut(s) 82, 152
BseXI GCAGC 1 cut(s) 166
Bsh1236I CGCG 1 cut(s) 132
BshFI GGCC 3 cut(s) 14, 56, 199
BslI CCNNNNNNNGG 2 cut(s) 136, 173
BsnI GGCC 3 cut(s) 14, 56, 199
Bsp143I GATC 2 cut(s) 6, 150
BspACI CCGC 2 cut(s) 108, 130
BspANI GGCC 3 cut(s) 14, 56, 199
BspFNI CGCG 1 cut(s) 132
BspLI GGNNCC 2 cut(s) 15, 106
BspPI GGATC 1 cut(s) 158
BsrI ACTGG 2 cut(s) 82, 152
BssECI CCNNGG 1 cut(s) 215
BssMI GATC 2 cut(s) 6, 150
Bst2UI CCWGG 2 cut(s) 94, 216
Bst6I CTCTTC 1 cut(s) 24
BstFNI CGCG 1 cut(s) 132
BstHHI GCGC 1 cut(s) 134
BstKTI GATC 2 cut(s) 9, 153
BstMBI GATC 2 cut(s) 6, 150
BstNI CCWGG 2 cut(s) 94, 216
BstSCI CCNGG 2 cut(s) 92, 214
BstSFI CTRYAG 1 cut(s) 239
BstUI CGCG 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 166
BstX2I RGATCY 2 cut(s) 6, 150
BstYI RGATCY 2 cut(s) 6, 150
BsuRI GGCC 3 cut(s) 14, 56, 199
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 2 cut(s) 42, 145
CfoI GCGC 1 cut(s) 134
Cfr13I GGNCC 4 cut(s) 13, 127, 164, 197
CviJI RGCY 7 cut(s) 14, 56, 92, 107, 199, 221, 238
CviKI_1 RGCY 7 cut(s) 14, 56, 92, 107, 199, 221, 238
DpnI GATC 2 cut(s) 8, 152
DpnII GATC 2 cut(s) 6, 150
EaeI YGGCCR 1 cut(s) 54
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco47I GGWCC 2 cut(s) 127, 164
EcoRII CCWGG 2 cut(s) 92, 214
FaiI YATR 1 cut(s) 241
FblI GTMKAC 1 cut(s) 117
Fnu4HI GCNGC 2 cut(s) 108, 180
Fsp4HI GCNGC 2 cut(s) 108, 180
FspBI CTAG 1 cut(s) 89
GlaI GCGC 1 cut(s) 133
GluI GCNGC 2 cut(s) 108, 180
HaeIII GGCC 3 cut(s) 14, 56, 199
HhaI GCGC 1 cut(s) 134
Hin6I GCGC 1 cut(s) 132
HinP1I GCGC 1 cut(s) 132
HinfI GANTC 1 cut(s) 97
Hpy166II GTNNAC 2 cut(s) 49, 118
Hpy188III TCNNGA 1 cut(s) 233
Hpy8I GTNNAC 2 cut(s) 49, 118
HpyAV CCTTC 1 cut(s) 216
HpyCH4V TGCA 2 cut(s) 4, 35
HspAI GCGC 1 cut(s) 132
Kzo9I GATC 2 cut(s) 6, 150
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 7 cut(s) 63, 79, 106, 133, 142, 201, 228
Lsp1109I GCAGC 1 cut(s) 166
LweI GCATC 1 cut(s) 90
MaeI CTAG 1 cut(s) 89
MalI GATC 2 cut(s) 8, 152
MboI GATC 2 cut(s) 6, 150
MboII GAAGA 3 cut(s) 11, 145, 221
MflI RGATCY 2 cut(s) 6, 150
MlsI TGGCCA 1 cut(s) 56
MluCI AATT 1 cut(s) 223
MluNI TGGCCA 1 cut(s) 56
MlyI GAGTC 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 1 cut(s) 27
Mox20I TGGCCA 1 cut(s) 56
MscI TGGCCA 1 cut(s) 56
Msp20I TGGCCA 1 cut(s) 56
MspR9I CCNGG 2 cut(s) 94, 216
MvaI CCWGG 2 cut(s) 94, 216
MvnI CGCG 1 cut(s) 132
NdeII GATC 2 cut(s) 6, 150
NlaIV GGNNCC 2 cut(s) 15, 106
PflMI CCANNNNNTGG 1 cut(s) 173
PkrI GCNGC 2 cut(s) 109, 181
PleI GAGTC 1 cut(s) 105
PpsI GAGTC 1 cut(s) 105
Psp6I CCWGG 2 cut(s) 92, 214
PspGI CCWGG 2 cut(s) 92, 214
PspN4I GGNNCC 2 cut(s) 15, 106
PspPI GGNCC 4 cut(s) 13, 127, 164, 197
PsuI RGATCY 2 cut(s) 6, 150
SatI GCNGC 2 cut(s) 108, 180
Sau3AI GATC 2 cut(s) 6, 150
Sau96I GGNCC 4 cut(s) 13, 127, 164, 197
SchI GAGTC 1 cut(s) 106
ScrFI CCNGG 2 cut(s) 94, 216
SetI ASST 2 cut(s) 90, 240
SfaNI GCATC 1 cut(s) 90
SfcI CTRYAG 1 cut(s) 239
SinI GGWCC 2 cut(s) 127, 164
Sse9I AATT 1 cut(s) 223
SsiI CCGC 2 cut(s) 108, 130
SspMI CTAG 1 cut(s) 89
StyD4I CCNGG 2 cut(s) 92, 214
TasI AATT 1 cut(s) 223
TauI GCSGC 1 cut(s) 110
TscAI CASTG 2 cut(s) 42, 152
TseI GCWGC 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 160
TspRI CASTG 2 cut(s) 42, 152
Van91I CCANNNNNTGG 1 cut(s) 173
VpaK11BI GGWCC 2 cut(s) 127, 164
XmiI GTMKAC 1 cut(s) 117
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.