MD03G1066700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0020366
Physical Location & Seq
Forward (+)
5334505 .. 5335269
765 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1066700.v1.1.491

Sequence Viewer

Length: 192 bp
ATGAGATGTAGTTGCGAGAAATGTGGAGTCTTATTCATACTAATTATCTTGAAAAAATGGGTGGAAGTAGAACCAAAGAATCGATGTCTAATCGTTGGAAATTACTTAGCCAATCGTTTAGTATTTGGAGAGACGCCTTGGCACAAGCTAATAGTAATCTTCGAAGTGGGGAAAATTACACGGATCAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.32

Weight (kDa)

9.34

Isoelectric Point (pI)

18.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020366)

Species Orthologous Gene IDs
malus_domestica MD03G1066700.v1.1
pyrus_communis pycom04g08680 pycom06g21610 pycom11g02830 pycom15g17860 pycom15g29930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 191
AcyI GRCGYC 1 cut(s) 134
AgsI TTSAA 1 cut(s) 52
AluBI AGCT 2 cut(s) 148, 189
AluI AGCT 2 cut(s) 148, 189
Alw26I GTCTC 1 cut(s) 125
AlwI GGATC 1 cut(s) 191
AsuII TTCGAA 1 cut(s) 162
BcoDI GTCTC 1 cut(s) 125
Bpu14I TTCGAA 1 cut(s) 162
Bsa29I ATCGAT 1 cut(s) 82
BsaHI GRCGYC 1 cut(s) 134
BsaJI CCNNGG 1 cut(s) 137
BseCI ATCGAT 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 137
BshVI ATCGAT 1 cut(s) 82
BsmAI GTCTC 1 cut(s) 125
BsmBI CGTCTC 1 cut(s) 125
Bsp119I TTCGAA 1 cut(s) 162
Bsp143I GATC 1 cut(s) 183
BspDI ATCGAT 1 cut(s) 82
BspPI GGATC 1 cut(s) 191
BspT104I TTCGAA 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 137
BssMI GATC 1 cut(s) 183
BssNI GRCGYC 1 cut(s) 134
BssT1I CCWWGG 1 cut(s) 137
BstACI GRCGYC 1 cut(s) 134
BstBI TTCGAA 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 106
BstKTI GATC 1 cut(s) 186
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 1 cut(s) 183
Bsu15I ATCGAT 1 cut(s) 82
BsuTUI ATCGAT 1 cut(s) 82
ClaI ATCGAT 1 cut(s) 82
CseI GACGC 1 cut(s) 142
CviJI RGCY 3 cut(s) 110, 148, 189
CviKI_1 RGCY 3 cut(s) 110, 148, 189
DdeI CTNAG 1 cut(s) 106
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 137
ErhI CCWWGG 1 cut(s) 137
Esp3I CGTCTC 1 cut(s) 125
FaiI YATR 1 cut(s) 38
HgaI GACGC 1 cut(s) 142
Hin1I GRCGYC 1 cut(s) 134
HinfI GANTC 2 cut(s) 27, 79
Hpy188III TCNNGA 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 106
Hsp92I GRCGYC 1 cut(s) 134
Kzo9I GATC 1 cut(s) 183
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 1 cut(s) 151
MluCI AATT 3 cut(s) 42, 100, 174
MlyI GAGTC 1 cut(s) 36
MmeI TCCRAC 1 cut(s) 76
NdeII GATC 1 cut(s) 183
NspV TTCGAA 1 cut(s) 162
PfeI GAWTC 1 cut(s) 79
PleI GAGTC 1 cut(s) 35
PpsI GAGTC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 183
SchI GAGTC 1 cut(s) 36
SetI ASST 2 cut(s) 150, 191
SfuI TTCGAA 1 cut(s) 162
SgeI CNNG 4 cut(s) 28, 61, 150, 157
Sse9I AATT 3 cut(s) 42, 100, 174
StyI CCWWGG 1 cut(s) 137
TaqI TCGA 2 cut(s) 82, 162
TasI AATT 3 cut(s) 42, 100, 174
TfiI GAWTC 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.