MD03G1071200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0019749
Physical Location & Seq
Forward (+)
5805653 .. 5808007
2355 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1071200.v1.1.491

Sequence Viewer

Length: 195 bp
ATGGGTTTGGGGAGAAAGAGTAAGGGAGCAGCTTCCGATCGCTTCCCTCTCTCCCTTAGAAACAATCAGTTTATAATCCCATTTAGCAGAGTCATGTCGCTTCCAAATGAAGAAAATGATAAGTCCTCTTCTTCTGATGCTCAGGGGATGGACAGAAGTCCCAGGCAGCAATCTCTCTGTAATGATCGCCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.19

Weight (kDa)

10.25

Isoelectric Point (pI)

71.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019749)

Species Orthologous Gene IDs
malus_domestica MD03G1071200.v1.1 MD06G1018000.v1.1 MD08G1049100.v1.1 MD11G1248100.v1.1 MD14G1169900.v1.1
pyrus_communis pycom02g22110 pycom03g05060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 74
AjnI CCWGG 1 cut(s) 161
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
ApeKI GCWGC 2 cut(s) 29, 166
BbvI GCAGC 2 cut(s) 41, 178
BccI CCATC 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 163
BisI GCNGC 2 cut(s) 30, 167
BlsI GCNGC 2 cut(s) 31, 168
Bme1390I CCNGG 1 cut(s) 163
BmrFI CCNGG 1 cut(s) 163
BmsI GCATC 1 cut(s) 127
BoxI GACNNNNGTC 1 cut(s) 156
Bpu10I CCTNAGC 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 161
BsaXI ACNNNNNCTCC 1 cut(s) 34
Bse118I RCCGGY 1 cut(s) 189
BseBI CCWGG 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 161
BseGI GGATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 155
BseXI GCAGC 2 cut(s) 41, 178
Bsh1285I CGRYCG 1 cut(s) 40
BsiEI CGRYCG 1 cut(s) 40
BsiSI CCGG 1 cut(s) 190
BslFI GGGAC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 144
Bsp143I GATC 2 cut(s) 37, 184
BspCNI CTCAG 1 cut(s) 154
BsrFI RCCGGY 1 cut(s) 189
BssAI RCCGGY 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 161
BssMI GATC 2 cut(s) 37, 184
Bst2UI CCWGG 1 cut(s) 163
Bst6I CTCTTC 1 cut(s) 133
BstDEI CTNAG 2 cut(s) 56, 141
BstF5I GGATG 1 cut(s) 153
BstKTI GATC 2 cut(s) 40, 187
BstMBI GATC 2 cut(s) 37, 184
BstMCI CGRYCG 1 cut(s) 40
BstNI CCWGG 1 cut(s) 163
BstPAI GACNNNNGTC 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 161
BstV1I GCAGC 2 cut(s) 41, 178
BtsCI GGATG 1 cut(s) 153
Cfr10I RCCGGY 1 cut(s) 189
CviAII CATG 1 cut(s) 94
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
DdeI CTNAG 2 cut(s) 56, 141
DpnI GATC 2 cut(s) 39, 186
DpnII GATC 2 cut(s) 37, 184
Eam1104I CTCTTC 1 cut(s) 133
EarI CTCTTC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 161
FaeI CATG 1 cut(s) 97
FaiI YATR 2 cut(s) 74, 95
FaqI GGGAC 1 cut(s) 144
FatI CATG 1 cut(s) 93
Fnu4HI GCNGC 2 cut(s) 30, 167
FokI GGATG 1 cut(s) 160
Fsp4HI GCNGC 2 cut(s) 30, 167
GluI GCNGC 2 cut(s) 30, 167
HapII CCGG 1 cut(s) 190
Hin1II CATG 1 cut(s) 97
HinfI GANTC 1 cut(s) 90
HpaII CCGG 1 cut(s) 190
Hpy188I TCNGA 2 cut(s) 37, 136
HpyF3I CTNAG 2 cut(s) 56, 141
Hsp92II CATG 1 cut(s) 97
Kzo9I GATC 2 cut(s) 37, 184
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 3 cut(s) 128, 148, 175
Lsp1109I GCAGC 2 cut(s) 41, 178
LweI GCATC 1 cut(s) 127
MalI GATC 2 cut(s) 39, 186
MboI GATC 2 cut(s) 37, 184
MboII GAAGA 3 cut(s) 120, 122, 123
MlyI GAGTC 1 cut(s) 99
MnlI CCTC 2 cut(s) 57, 136
MspI CCGG 1 cut(s) 190
MspR9I CCNGG 1 cut(s) 163
MvaI CCWGG 1 cut(s) 163
NdeII GATC 2 cut(s) 37, 184
NlaIII CATG 1 cut(s) 97
PkrI GCNGC 2 cut(s) 31, 168
Ple19I CGATCG 1 cut(s) 40
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
PshAI GACNNNNGTC 1 cut(s) 156
PsiI TTATAA 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PvuI CGATCG 1 cut(s) 40
SatI GCNGC 2 cut(s) 30, 167
Sau3AI GATC 2 cut(s) 37, 184
SchI GAGTC 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 163
SetI ASST 1 cut(s) 34
SfaNI GCATC 1 cut(s) 127
SgeI CNNG 4 cut(s) 106, 155, 174, 175
StyD4I CCNGG 1 cut(s) 161
TseI GCWGC 2 cut(s) 29, 166
TspDTI ATGAA 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.