MD05G1127800.v1.1

PsaA and PsaB bind P700, the primary electron donor of photosystem I (PSI), as well as the electron acceptors A0, A1 and FX. PSI is a plastocyanin-ferredoxin oxidoreductase, converting photonic excitation into a charge separation, which transfers an electron from the donor P700 chlorophyll pair to the spectroscopically characterized acceptors A0, A1, FX, FA and FB in turn. Oxidized P700 is reduced on the lumenal side of the thylakoid membrane by plastocyanin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0013910
Physical Location & Seq
Forward (+)
25135888 .. 25136238
351 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1127800.v1.1.491

Sequence Viewer

Length: 351 bp
ATGTTGAATCACCATTTAGCATGGCTACCAGGCCTTGGTTCTCTTTCTTGGGCGGGGCATCAAGTACATGTATCTTTACCAATTAACCAATTTCTAAATGCTGAAGTAGATCCTAAAGAGATTCTGCTCCTTCATGAATTTATCTTGAATCGGGATCTTTTGGCTCAACTTCATCCCAATTTTGCTAAAGCAACAACCTTATTTTTCACCTTGAATTGGTCAAAATATGCAGAATTTCTTACTTTTCGTGGAGGATTAGATCCAATAATTGGAAGTTTTTGGCTGACCGATATTGCACACCATCATTTAGCTATTGCGATTCTTTTTCTGGTAGTGGGGTCACATGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00195 ko01100 map00195 map01100
Pfam Domains
Protein Families
PsaA_PsaB

Protein Analysis

117

Amino Acids

13.11

Weight (kDa)

6.33

Isoelectric Point (pI)

17.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsaA_PsaB PF00223 1 - 113 1.2e-28 Photosystem I psaA/psaB protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 35, 269
AciI CCGC 1 cut(s) 53
AclWI GGATC 3 cut(s) 104, 162, 254
AcsI RAATTY 2 cut(s) 137, 233
AcuI CTGAAG 1 cut(s) 123
AfaI GTAC 1 cut(s) 66
AfiI CCNNNNNNNGG 3 cut(s) 35, 216, 269
AflIII ACRYGT 2 cut(s) 67, 343
AgsI TTSAA 3 cut(s) 7, 148, 214
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 1 cut(s) 311
AluI AGCT 1 cut(s) 311
AlwI GGATC 3 cut(s) 104, 162, 254
AoxI GGCC 1 cut(s) 31
ApoI RAATTY 2 cut(s) 137, 233
AsuHPI GGTGA 1 cut(s) 199
BccI CCATC 1 cut(s) 309
BciT130I CCWGG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 3 cut(s) 35, 216, 269
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 172
BseLI CCNNNNNNNGG 3 cut(s) 35, 216, 269
BshFI GGCC 1 cut(s) 33
BslI CCNNNNNNNGG 3 cut(s) 35, 216, 269
BsnI GGCC 1 cut(s) 33
Bsp143I GATC 3 cut(s) 109, 154, 259
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 33
BspHI TCATGA 1 cut(s) 133
BspPI GGATC 3 cut(s) 104, 162, 254
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 3 cut(s) 109, 154, 259
BssT1I CCWWGG 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 3 cut(s) 112, 157, 262
BstMBI GATC 3 cut(s) 109, 154, 259
BstNI CCWGG 1 cut(s) 30
BstNSI RCATGY 2 cut(s) 71, 347
BstSCI CCNGG 1 cut(s) 28
BstX2I RGATCY 3 cut(s) 109, 154, 259
BstYI RGATCY 3 cut(s) 109, 154, 259
BsuRI GGCC 1 cut(s) 33
BtsCI GGATG 1 cut(s) 172
CciI TCATGA 1 cut(s) 133
Csp6I GTAC 1 cut(s) 65
CviAII CATG 4 cut(s) 21, 68, 134, 344
CviJI RGCY 5 cut(s) 25, 33, 164, 283, 311
CviKI_1 RGCY 5 cut(s) 25, 33, 164, 283, 311
CviQI GTAC 1 cut(s) 65
DpnI GATC 3 cut(s) 111, 156, 261
DpnII GATC 3 cut(s) 109, 154, 259
Eco130I CCWWGG 1 cut(s) 34
Eco147I AGGCCT 1 cut(s) 33
Eco57I CTGAAG 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 28
EcoT14I CCWWGG 1 cut(s) 34
ErhI CCWWGG 1 cut(s) 34
FaeI CATG 4 cut(s) 24, 71, 137, 347
FaiI YATR 6 cut(s) 22, 69, 135, 228, 345, 349
FatI CATG 4 cut(s) 20, 67, 133, 343
FauI CCCGC 1 cut(s) 46
FokI GGATG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 33
Hin1II CATG 4 cut(s) 24, 71, 137, 347
HinfI GANTC 4 cut(s) 7, 121, 148, 319
HphI GGTGA 1 cut(s) 199
Hpy188III TCNNGA 3 cut(s) 134, 145, 152
HpyAV CCTTC 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 230, 296
Hsp92II CATG 4 cut(s) 24, 71, 137, 347
Kzo9I GATC 3 cut(s) 109, 154, 259
LmnI GCTCC 1 cut(s) 132
LpnPI CCDG 3 cut(s) 15, 42, 314
LweI GCATC 1 cut(s) 67
MaeIII GTNAC 1 cut(s) 339
MalI GATC 3 cut(s) 111, 156, 261
MboI GATC 3 cut(s) 109, 154, 259
MflI RGATCY 3 cut(s) 109, 154, 259
MluCI AATT 7 cut(s) 81, 89, 137, 178, 214, 233, 267
MnlI CCTC 1 cut(s) 245
MseI TTAA 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NdeII GATC 3 cut(s) 109, 154, 259
NlaIII CATG 4 cut(s) 24, 71, 137, 347
NmuCI GTSAC 1 cut(s) 339
NspI RCATGY 2 cut(s) 71, 347
PagI TCATGA 1 cut(s) 133
PceI AGGCCT 1 cut(s) 33
PciI ACATGT 2 cut(s) 67, 343
PfeI GAWTC 4 cut(s) 7, 121, 148, 319
PflMI CCANNNNNTGG 2 cut(s) 35, 269
PscI ACATGT 2 cut(s) 67, 343
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PsuI RGATCY 3 cut(s) 109, 154, 259
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 3 cut(s) 109, 154, 259
ScrFI CCNGG 1 cut(s) 30
SetI ASST 3 cut(s) 200, 212, 313
SfaNI GCATC 1 cut(s) 67
Sse9I AATT 7 cut(s) 81, 89, 137, 178, 214, 233, 267
SseBI AGGCCT 1 cut(s) 33
SsiI CCGC 1 cut(s) 53
StuI AGGCCT 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 28
StyI CCWWGG 1 cut(s) 34
TaqII GACCGA 1 cut(s) 302
TasI AATT 7 cut(s) 81, 89, 137, 178, 214, 233, 267
TatI WGTACW 1 cut(s) 64
TfiI GAWTC 4 cut(s) 7, 121, 148, 319
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseFI GTSAC 1 cut(s) 339
Tsp45I GTSAC 1 cut(s) 339
TspDTI ATGAA 3 cut(s) 122, 150, 161
Van91I CCANNNNNTGG 2 cut(s) 35, 269
XapI RAATTY 2 cut(s) 137, 233
XceI RCATGY 2 cut(s) 71, 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.