pycom1353g00050

PsaA and PsaB bind P700, the primary electron donor of photosystem I (PSI), as well as the electron acceptors A0, A1 and FX. PSI is a plastocyanin-ferredoxin oxidoreductase, converting photonic excitation into a charge separation, which transfers an electron from the donor P700 chlorophyll pair to the spectroscopically characterized acceptors A0, A1, FX, FA and FB in turn. Oxidized P700 is reduced on the lumenal side of the thylakoid membrane by plastocyanin

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001353
Physical Location & Seq
Reverse (-)
93749 .. 94705
957 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1353g00050.2

Sequence Viewer

Length: 633 bp
ATGACTATTCGTTCCCCGAAACCAAAAGTTCAAATTTTGGTAAATAGGGATTTCGTAAAAACTTCTTTCAAGGAATGGAACCTACACGCTAATGCTCACGATTTTGATAGCCATACCAGTGATATGGAGGAGATCTCTCAAAAAGTATTTAGTGCCCATTTTAGACAACTATCCATCTTCTTTCTTTGGCTGAGTGATATGTATTTTCATGGTGCTCGTTTTTCCAATTATGAAGCATGGCTAAGTGTTCCTACTCACATTGGACCTAGTGCCAGGGTGGTTTGGTCAATAGTGCATCAAGAAATATTAAATGGTGATGTGGGCAGGATTTGGCGAGCATTTGGAATAACTAGTGAATTACAACTCTATTGTACTGCAATTGGTGCATTCTTCTTTATTACCTTAATGATTTTTGCTGGTTGGTTCTATTATCACAAAGCTGCTCCGAACGACCCTTTTTTCACCTTGAATTGGTCAAAATATGCAGAATTTGTTACTTTTCATGGAAGATTAAATCTAGTAATTAGAGGTCTTTGGCTGACGGATAAGACACACCATCATTTAACTAATGTAATTATTTTCCTGGTAGCGGGTTACATGTATAGGACAAACTGGGGAGACTTAGAAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

211

Amino Acids

24.6

Weight (kDa)

7.96

Isoelectric Point (pI)

33.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 590
AcsI RAATTY 2 cut(s) 33, 488
AfaI GTAC 1 cut(s) 373
AfiI CCNNNNNNNGG 2 cut(s) 471, 589
AflIII ACRYGT 1 cut(s) 597
AgsI TTSAA 3 cut(s) 32, 70, 469
AhlI ACTAGT 1 cut(s) 350
AjnI CCWGG 2 cut(s) 272, 582
AluBI AGCT 1 cut(s) 440
AluI AGCT 1 cut(s) 440
Alw21I GWGCWC 1 cut(s) 217
Alw26I GTCTC 1 cut(s) 612
ApeKI GCWGC 1 cut(s) 440
ApoI RAATTY 2 cut(s) 33, 488
AspS9I GGNCC 1 cut(s) 263
AsuHPI GGTGA 2 cut(s) 326, 454
AvaII GGWCC 1 cut(s) 263
BaeGI GKGCMC 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 217
BbvI GCAGC 1 cut(s) 427
BccI CCATC 2 cut(s) 182, 564
BciT130I CCWGG 2 cut(s) 274, 584
BcoDI GTCTC 1 cut(s) 612
BcuI ACTAGT 1 cut(s) 350
BfaI CTAG 3 cut(s) 267, 351, 518
BglII AGATCT 1 cut(s) 132
BisI GCNGC 1 cut(s) 441
BlsI GCNGC 1 cut(s) 442
Bme1390I CCNGG 2 cut(s) 274, 584
Bme18I GGWCC 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 263
BmiI GGNNCC 1 cut(s) 80
BmrFI CCNGG 2 cut(s) 274, 584
BmrI ACTGGG 1 cut(s) 622
BmsI GCATC 1 cut(s) 304
BmuI ACTGGG 1 cut(s) 622
BplI GAGNNNNNCTC 2 cut(s) 119, 151
BsaJI CCNNGG 1 cut(s) 273
Bsc4I CCNNNNNNNGG 2 cut(s) 471, 589
Bse1I ACTGG 2 cut(s) 117, 617
BseBI CCWGG 2 cut(s) 274, 584
BseDI CCNNGG 1 cut(s) 273
BseLI CCNNNNNNNGG 2 cut(s) 471, 589
BseMII CTCAG 1 cut(s) 182
BseNI ACTGG 2 cut(s) 117, 617
BseRI GAGGAG 1 cut(s) 143
BseSI GKGCMC 1 cut(s) 157
BseXI GCAGC 1 cut(s) 427
BsiHKAI GWGCWC 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 471, 589
BsmAI GTCTC 1 cut(s) 612
BsmI GAATGC 1 cut(s) 386
Bsp1286I GDGCHC 2 cut(s) 157, 217
Bsp143I GATC 1 cut(s) 132
BspACI CCGC 1 cut(s) 590
BspCNI CTCAG 1 cut(s) 183
BspLI GGNNCC 1 cut(s) 80
BsrI ACTGG 2 cut(s) 117, 617
BssECI CCNNGG 1 cut(s) 273
BssMI GATC 1 cut(s) 132
Bst2UI CCWGG 2 cut(s) 274, 584
BstAPI GCANNNNNTGC 1 cut(s) 383
BstC8I GCNNGC 1 cut(s) 336
BstDEI CTNAG 3 cut(s) 191, 242, 622
BstKTI GATC 1 cut(s) 135
BstMAI GTCTC 1 cut(s) 612
BstMBI GATC 1 cut(s) 132
BstMWI GCNNNNNNNGC 1 cut(s) 383
BstNI CCWGG 2 cut(s) 274, 584
BstNSI RCATGY 1 cut(s) 601
BstSCI CCNGG 2 cut(s) 272, 582
BstSLI GKGCMC 1 cut(s) 157
BstV1I GCAGC 1 cut(s) 427
BstX2I RGATCY 1 cut(s) 132
BstXI CCANNNNNNTGG 1 cut(s) 124
BstYI RGATCY 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 336
Cfr13I GGNCC 1 cut(s) 263
Csp6I GTAC 1 cut(s) 372
CviAII CATG 4 cut(s) 209, 237, 503, 598
CviJI RGCY 5 cut(s) 111, 190, 241, 440, 538
CviKI_1 RGCY 5 cut(s) 111, 190, 241, 440, 538
CviQI GTAC 1 cut(s) 372
DdeI CTNAG 3 cut(s) 191, 242, 622
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 263
EcoRII CCWGG 2 cut(s) 272, 582
FaeI CATG 4 cut(s) 212, 240, 506, 601
FatI CATG 4 cut(s) 208, 236, 502, 597
FauI CCCGC 1 cut(s) 583
Fnu4HI GCNGC 1 cut(s) 441
Fsp4HI GCNGC 1 cut(s) 441
FspBI CTAG 3 cut(s) 267, 351, 518
GluI GCNGC 1 cut(s) 441
Hin1II CATG 4 cut(s) 212, 240, 506, 601
HphI GGTGA 2 cut(s) 326, 454
Hpy188I TCNGA 1 cut(s) 447
Hpy188III TCNNGA 2 cut(s) 98, 299
HpyAV CCTTC 1 cut(s) 620
HpyCH4V TGCA 4 cut(s) 295, 377, 386, 485
HpyF10VI GCNNNNNNNGC 1 cut(s) 383
HpyF3I CTNAG 3 cut(s) 191, 242, 622
Hsp92II CATG 4 cut(s) 212, 240, 506, 601
Kzo9I GATC 1 cut(s) 132
LmnI GCTCC 1 cut(s) 448
LpnPI CCDG 8 cut(s) 130, 259, 286, 310, 402, 569, 596, 598
Lsp1109I GCAGC 1 cut(s) 427
LweI GCATC 1 cut(s) 304
MaeI CTAG 3 cut(s) 267, 351, 518
MaeIII GTNAC 2 cut(s) 493, 593
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MboII GAAGA 3 cut(s) 169, 382, 519
MfeI CAATTG 1 cut(s) 378
MflI RGATCY 1 cut(s) 132
MhlI GDGCHC 2 cut(s) 157, 217
MluCI AATT 8 cut(s) 33, 226, 356, 378, 469, 488, 522, 573
MnlI CCTC 2 cut(s) 121, 521
MseI TTAA 4 cut(s) 308, 404, 512, 563
MslI CAYNNNNRTG 2 cut(s) 90, 117
MspR9I CCNGG 2 cut(s) 274, 584
MunI CAATTG 1 cut(s) 378
Mva1269I GAATGC 1 cut(s) 386
MvaI CCWGG 2 cut(s) 274, 584
MwoI GCNNNNNNNGC 1 cut(s) 383
NdeII GATC 1 cut(s) 132
NlaIII CATG 4 cut(s) 212, 240, 506, 601
NlaIV GGNNCC 1 cut(s) 80
NspI RCATGY 1 cut(s) 601
PciI ACATGT 1 cut(s) 597
PctI GAATGC 1 cut(s) 386
PkrI GCNGC 1 cut(s) 442
PscI ACATGT 1 cut(s) 597
Psp6I CCWGG 2 cut(s) 272, 582
PspGI CCWGG 2 cut(s) 272, 582
PspN4I GGNNCC 1 cut(s) 80
PspPI GGNCC 1 cut(s) 263
PsuI RGATCY 1 cut(s) 132
RsaI GTAC 1 cut(s) 373
RsaNI GTAC 1 cut(s) 372
RseI CAYNNNNRTG 2 cut(s) 90, 117
SaqAI TTAA 4 cut(s) 308, 404, 512, 563
SatI GCNGC 1 cut(s) 441
Sau3AI GATC 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 263
ScrFI CCNGG 2 cut(s) 274, 584
SduI GDGCHC 2 cut(s) 157, 217
SetI ASST 6 cut(s) 84, 268, 404, 442, 467, 532
SfaNI GCATC 1 cut(s) 304
SinI GGWCC 1 cut(s) 263
SmiMI CAYNNNNRTG 2 cut(s) 90, 117
SpeI ACTAGT 1 cut(s) 350
Sse9I AATT 8 cut(s) 33, 226, 356, 378, 469, 488, 522, 573
SsiI CCGC 1 cut(s) 590
SspI AATATT 1 cut(s) 306
SspMI CTAG 3 cut(s) 267, 351, 518
StyD4I CCNGG 2 cut(s) 272, 582
TasI AATT 8 cut(s) 33, 226, 356, 378, 469, 488, 522, 573
TatI WGTACW 1 cut(s) 371
Tru1I TTAA 4 cut(s) 308, 404, 512, 563
Tru9I TTAA 4 cut(s) 308, 404, 512, 563
TscAI CASTG 1 cut(s) 124
TseI GCWGC 1 cut(s) 440
TspDTI ATGAA 3 cut(s) 197, 246, 491
TspGWI ACGGA 1 cut(s) 557
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 263
XapI RAATTY 2 cut(s) 33, 488
XceI RCATGY 1 cut(s) 601
XspI CTAG 3 cut(s) 267, 351, 518
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.