MD07G1078200.v1.1

Domain of unknown function (DUF4787)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
7487226 .. 7492606
5381 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1078200.v1.1.491

Sequence Viewer

Length: 381 bp
ATGGCAAATCATAATTTTTCATCTTCTTCCCTGCTCAGAATTCTAATTCTTCTACTAGTATTCTTGCACTTCTCTCCCATCAATACAAATGCCAAGTCTCGTCGCCCAATCTCTGATATTGAGACAAGGCAGAAGAAGAGCCAGTGTTATGCTGACATTCAGAGCGGATTGTGGGGTTGGCAATGCAAATCCTCCTTGATAGCAAAAGAAAATTGCGCTTTGCGATGCCTTTCTCCTACTTGCTATGAGCTTATCTACGAGAGCGATCCGCTTGAAGAAGGTGAAAAAGATATGCTTAGGGGCCAAGAGTTCAAATACTGTATGCATAAGTTATCTTTGGGGGAGAGCCTCGAGGGTATTAAGGGTTCATTTAATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.41

Weight (kDa)

7.59

Isoelectric Point (pI)

59.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4787 PF16029 39 - 107 2.2e-24 Domain of unknown function (DUF4787)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013556)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 350
AccBSI CCGCTC 1 cut(s) 165
AciI CCGC 2 cut(s) 165, 269
AclWI GGATC 1 cut(s) 260
AcsI RAATTY 1 cut(s) 39
AgsI TTSAA 2 cut(s) 275, 313
AhlI ACTAGT 1 cut(s) 55
AluBI AGCT 1 cut(s) 250
AluI AGCT 1 cut(s) 250
Alw26I GTCTC 2 cut(s) 102, 116
AlwI GGATC 1 cut(s) 260
Ama87I CYCGRG 1 cut(s) 350
AoxI GGCC 1 cut(s) 301
ApoI RAATTY 1 cut(s) 39
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
AspLEI GCGC 1 cut(s) 218
AspS9I GGNCC 1 cut(s) 301
AsuHPI GGTGA 1 cut(s) 293
AvaI CYCGRG 1 cut(s) 350
BccI CCATC 1 cut(s) 86
BcoDI GTCTC 2 cut(s) 102, 116
BcuI ACTAGT 1 cut(s) 55
BfaI CTAG 1 cut(s) 56
BmeT110I CYCGRG 1 cut(s) 350
BmgT120I GGNCC 1 cut(s) 301
BmiI GGNNCC 1 cut(s) 302
BmsI GCATC 1 cut(s) 215
Bpu10I CCTNAGC 1 cut(s) 296
Bse1I ACTGG 1 cut(s) 142
Bse3DI GCAATG 1 cut(s) 188
BseMI GCAATG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 142
BshFI GGCC 1 cut(s) 303
BsiHKCI CYCGRG 1 cut(s) 350
BsmAI GTCTC 2 cut(s) 102, 116
BsnI GGCC 1 cut(s) 303
BsoBI CYCGRG 1 cut(s) 350
Bsp143I GATC 1 cut(s) 265
BspACI CCGC 2 cut(s) 165, 269
BspANI GGCC 1 cut(s) 303
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 1 cut(s) 302
BspPI GGATC 1 cut(s) 260
BspQI GCTCTTC 1 cut(s) 131
BsrBI CCGCTC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 188
BsrI ACTGG 1 cut(s) 142
BssMI GATC 1 cut(s) 265
Bst4CI ACNGT 1 cut(s) 320
Bst6I CTCTTC 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 35, 296
BstHHI GCGC 1 cut(s) 218
BstKTI GATC 1 cut(s) 268
BstMAI GTCTC 2 cut(s) 102, 116
BstMBI GATC 1 cut(s) 265
BsuRI GGCC 1 cut(s) 303
BtgZI GCGATG 1 cut(s) 238
BtsIMutI CAGTG 1 cut(s) 149
CfoI GCGC 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 301
CviJI RGCY 4 cut(s) 141, 250, 303, 348
CviKI_1 RGCY 4 cut(s) 141, 250, 303, 348
DdeI CTNAG 2 cut(s) 35, 296
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco88I CYCGRG 1 cut(s) 350
EcoRI GAATTC 1 cut(s) 39
EcoT22I ATGCAT 1 cut(s) 327
FaiI YATR 6 cut(s) 12, 150, 246, 293, 323, 327
FalI AAGNNNNNCTT 2 cut(s) 279, 311
FspBI CTAG 1 cut(s) 56
GlaI GCGC 1 cut(s) 217
HaeIII GGCC 1 cut(s) 303
HhaI GCGC 1 cut(s) 218
Hin6I GCGC 1 cut(s) 216
HinP1I GCGC 1 cut(s) 216
HphI GGTGA 1 cut(s) 293
Hpy188I TCNGA 3 cut(s) 38, 115, 162
Hpy99I CGWCG 1 cut(s) 105
HpyAV CCTTC 1 cut(s) 272
HpyCH4III ACNGT 1 cut(s) 320
HpyCH4V TGCA 3 cut(s) 67, 186, 325
HpyF3I CTNAG 2 cut(s) 35, 296
HspAI GCGC 1 cut(s) 216
Kzo9I GATC 1 cut(s) 265
LguI GCTCTTC 1 cut(s) 131
LpnPI CCDG 2 cut(s) 44, 155
LweI GCATC 1 cut(s) 215
MaeI CTAG 1 cut(s) 56
MalI GATC 1 cut(s) 267
MbiI CCGCTC 1 cut(s) 165
MboI GATC 1 cut(s) 265
MboII GAAGA 6 cut(s) 15, 18, 41, 145, 148, 287
MluCI AATT 5 cut(s) 13, 39, 45, 211, 373
MnlI CCTC 3 cut(s) 202, 346, 359
Mph1103I ATGCAT 1 cut(s) 327
MseI TTAA 3 cut(s) 360, 372, 379
NdeII GATC 1 cut(s) 265
NlaIV GGNNCC 1 cut(s) 302
NsiI ATGCAT 1 cut(s) 327
PaeR7I CTCGAG 1 cut(s) 350
PciSI GCTCTTC 1 cut(s) 131
PspN4I GGNNCC 1 cut(s) 302
PspPI GGNCC 1 cut(s) 301
PspXI VCTCGAGB 1 cut(s) 350
PsrI GAACNNNNNNTAC 2 cut(s) 349, 381
SapI GCTCTTC 1 cut(s) 131
SaqAI TTAA 3 cut(s) 360, 372, 379
Sau3AI GATC 1 cut(s) 265
Sau96I GGNCC 1 cut(s) 301
SetI ASST 2 cut(s) 252, 283
SfaNI GCATC 1 cut(s) 215
Sfr274I CTCGAG 1 cut(s) 350
SlaI CTCGAG 1 cut(s) 350
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
SpeI ACTAGT 1 cut(s) 55
Sse9I AATT 5 cut(s) 13, 39, 45, 211, 373
SsiI CCGC 2 cut(s) 165, 269
SspMI CTAG 1 cut(s) 56
TaaI ACNGT 1 cut(s) 320
TaqI TCGA 1 cut(s) 351
TasI AATT 5 cut(s) 13, 39, 45, 211, 373
Tru1I TTAA 3 cut(s) 360, 372, 379
Tru9I TTAA 3 cut(s) 360, 372, 379
TscAI CASTG 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 9, 357
TspRI CASTG 1 cut(s) 149
XapI RAATTY 1 cut(s) 39
XhoI CTCGAG 1 cut(s) 350
XspI CTAG 1 cut(s) 56
Zsp2I ATGCAT 1 cut(s) 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.