MD07G1078900.v1.1
ERF Family

Belongs to the GST superfamily

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
7615942 .. 7616634
693 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1078900.v1.1.491

Sequence Viewer

Length: 213 bp
ATGTGCTGTCTGATCAGTTCGCAAATTTCTGCAGTAAACTGCAGGATATTTGGCTACATTTTTTCATTTAGTGGTGTATTATGCCAAGAGGAAGCTATTGTAAAAGCCAAGGAGAACTTGAAGTACTTGGAAGAAGAGCTAAAGGGAAAGAAATTCTTTGGCGGAGAGAAACTTGGATTTGCGGATATTGCACTTGGATGGCTCGCACACTAA

Protein Analysis

71

Amino Acids

7.79

Weight (kDa)

6.54

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GST_C PF00043 29 - 65 1.8e-07 Glutathione S-transferase, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020399)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 162, 182
AcsI RAATTY 2 cut(s) 24, 152
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 2 cut(s) 95, 139
AluI AGCT 2 cut(s) 95, 139
ApoI RAATTY 2 cut(s) 24, 152
BccI CCATC 1 cut(s) 192
BclI TGATCA 1 cut(s) 12
BfmI CTRYAG 2 cut(s) 30, 40
BmcAI AGTACT 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 203
Bsp143I GATC 1 cut(s) 12
BspACI CCGC 2 cut(s) 162, 182
BspMAI CTGCAG 2 cut(s) 34, 44
BspQI GCTCTTC 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 108
Bst6I CTCTTC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 204
BstF5I GGATG 1 cut(s) 203
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstSFI CTRYAG 2 cut(s) 30, 40
BtsCI GGATG 1 cut(s) 203
Cac8I GCNNGC 1 cut(s) 204
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 5 cut(s) 54, 95, 107, 139, 202
CviKI_1 RGCY 5 cut(s) 54, 95, 107, 139, 202
CviQI GTAC 1 cut(s) 124
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
EciI GGCGGA 1 cut(s) 177
Eco130I CCWWGG 1 cut(s) 108
EcoT14I CCWWGG 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 108
FaiI YATR 1 cut(s) 82
FalI AAGNNNNNCTT 4 cut(s) 101, 133, 140, 172
FbaI TGATCA 1 cut(s) 12
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 12
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4V TGCA 3 cut(s) 32, 42, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
Ksp22I TGATCA 1 cut(s) 12
Kzo9I GATC 1 cut(s) 12
LguI GCTCTTC 1 cut(s) 129
LpnPI CCDG 1 cut(s) 28
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MboII GAAGA 2 cut(s) 143, 146
MluCI AATT 2 cut(s) 24, 152
MnlI CCTC 1 cut(s) 82
MslI CAYNNNNRTG 1 cut(s) 196
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeII GATC 1 cut(s) 12
PciSI GCTCTTC 1 cut(s) 129
PsrI GAACNNNNNNTAC 2 cut(s) 107, 139
PstI CTGCAG 2 cut(s) 34, 44
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
RseI CAYNNNNRTG 1 cut(s) 196
SapI GCTCTTC 1 cut(s) 129
Sau3AI GATC 1 cut(s) 12
ScaI AGTACT 1 cut(s) 125
SetI ASST 2 cut(s) 97, 141
SfcI CTRYAG 2 cut(s) 30, 40
SgeI CNNG 7 cut(s) 55, 98, 121, 130, 139, 185, 206
SmiMI CAYNNNNRTG 1 cut(s) 196
Sse9I AATT 2 cut(s) 24, 152
SsiI CCGC 2 cut(s) 162, 182
StyI CCWWGG 1 cut(s) 108
TasI AATT 2 cut(s) 24, 152
TatI WGTACW 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 54
XapI RAATTY 2 cut(s) 24, 152
ZrmI AGTACT 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.