MD07G1185500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
26654766 .. 26655541
776 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1185500.v1.1.491

Sequence Viewer

Length: 201 bp
ATGATTATATCTCAGAACCAAATTCGAAATGACAATTCTATAAGATACCATGTCAAATCTCAACAAGAAATAAGTATGCCAAGTGAAATAAACCAGCTGAGTGTAAATAAATACGCTCAAGTGCTATTGTCACATGAAGGTTGTGCCAAGTATCGCAAGTCACTTATAAGTCAAAACCACCTAAAGTGGTCTGTACGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.74

Weight (kDa)

9.8

Isoelectric Point (pI)

44.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019785)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 167
AcsI RAATTY 1 cut(s) 21
AfaI GTAC 1 cut(s) 195
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
ApoI RAATTY 1 cut(s) 21
AsuII TTCGAA 1 cut(s) 25
Bpu14I TTCGAA 1 cut(s) 25
BpuEI CTTGAG 1 cut(s) 102
BseMII CTCAG 2 cut(s) 26, 89
Bsp119I TTCGAA 1 cut(s) 25
BspCNI CTCAG 2 cut(s) 25, 90
BspT104I TTCGAA 1 cut(s) 25
BstBI TTCGAA 1 cut(s) 25
BstDEI CTNAG 2 cut(s) 12, 98
Csp6I GTAC 1 cut(s) 194
CviAII CATG 2 cut(s) 50, 134
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
CviQI GTAC 1 cut(s) 194
DdeI CTNAG 2 cut(s) 12, 98
FaeI CATG 2 cut(s) 53, 137
FaiI YATR 6 cut(s) 8, 41, 51, 77, 135, 167
FatI CATG 2 cut(s) 49, 133
FspEI CC 9 cut(s) 32, 62, 93, 107, 123, 160, 172, 191, 194
Hin1II CATG 2 cut(s) 53, 137
Hpy188I TCNGA 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 131
HpyF3I CTNAG 2 cut(s) 12, 98
Hsp92II CATG 2 cut(s) 53, 137
LpnPI CCDG 1 cut(s) 107
MaeIII GTNAC 2 cut(s) 129, 159
MluCI AATT 2 cut(s) 21, 34
MspA1I CMGCKG 1 cut(s) 97
NlaIII CATG 2 cut(s) 53, 137
NmuCI GTSAC 2 cut(s) 129, 159
NspV TTCGAA 1 cut(s) 25
PsiI TTATAA 1 cut(s) 167
PvuII CAGCTG 1 cut(s) 97
RsaI GTAC 1 cut(s) 195
RsaNI GTAC 1 cut(s) 194
SetI ASST 3 cut(s) 99, 142, 183
SfuI TTCGAA 1 cut(s) 25
SgeI CNNG 8 cut(s) 62, 77, 93, 106, 131, 146, 160, 169
SmlI CTYRAG 1 cut(s) 117
SmoI CTYRAG 1 cut(s) 117
Sse9I AATT 2 cut(s) 21, 34
TaqI TCGA 1 cut(s) 25
TasI AATT 2 cut(s) 21, 34
TseFI GTSAC 2 cut(s) 129, 159
Tsp45I GTSAC 2 cut(s) 129, 159
TspDTI ATGAA 1 cut(s) 150
XapI RAATTY 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.