MD08G1073600.v1.1

30S ribosomal protein S15

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
5941810 .. 5942046
237 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1073600.v1.1.491

Sequence Viewer

Length: 237 bp
ATGGTAAAAAAATTCATTCATCTTAGTTATTTCACAAGAAAAAAAAAAGACGAAAACAGAGGATCTGTTGAATTTCAAATAGTTAGTTTCACCAATAGGATACGAAGACTTACTTCACATTTACAATTACACAAAAAAAACTATTTATCTCAGAGAGGTTTACGTAAAATTCTGGGAAAACGTCAACGATTACTGTCTTATTTGTCAAAGAAAAATAGAATATGTATAAAGAATTAA

Protein Analysis

79

Amino Acids

9.49

Weight (kDa)

11.51

Isoelectric Point (pI)

31.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 14 - 73 2.5e-19 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020234)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG01120
malus_domestica MD08G1073600.v1.1 MD09G1289300.v1.1 MD12G1214000.v1.1 MD12G1237700.v1.1
rosa_chinensis RchiOBHm_Chr3g0470821

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 70
AcsI RAATTY 3 cut(s) 11, 71, 168
AgsI TTSAA 2 cut(s) 71, 77
AlwI GGATC 1 cut(s) 70
ApoI RAATTY 3 cut(s) 11, 71, 168
AsuHPI GGTGA 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 112
BciVI GTATCC 1 cut(s) 93
BfuI GTATCC 1 cut(s) 93
BpiI GAAGAC 1 cut(s) 112
BsaAI YACGTR 1 cut(s) 164
BseMII CTCAG 1 cut(s) 164
Bsp143I GATC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 163
BspPI GGATC 1 cut(s) 70
BssMI GATC 1 cut(s) 62
Bst4CI ACNGT 1 cut(s) 195
BstBAI YACGTR 1 cut(s) 164
BstDEI CTNAG 2 cut(s) 23, 150
BstKTI GATC 1 cut(s) 65
BstMBI GATC 1 cut(s) 62
BstSNI TACGTA 1 cut(s) 164
BstV2I GAAGAC 1 cut(s) 112
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BsuI GTATCC 1 cut(s) 93
DdeI CTNAG 2 cut(s) 23, 150
DpnI GATC 1 cut(s) 64
DpnII GATC 1 cut(s) 62
Eco105I TACGTA 1 cut(s) 164
FaiI YATR 2 cut(s) 223, 227
FalI AAGNNNNNCTT 2 cut(s) 97, 129
FspEI CC 6 cut(s) 45, 82, 106, 141, 158, 159
HincII GTYRAC 1 cut(s) 185
HindII GTYRAC 1 cut(s) 185
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 2 cut(s) 161, 185
Hpy188I TCNGA 1 cut(s) 153
Hpy8I GTNNAC 2 cut(s) 161, 185
HpyCH4III ACNGT 1 cut(s) 195
HpyCH4IV ACGT 2 cut(s) 163, 181
HpyF3I CTNAG 2 cut(s) 23, 150
HpySE526I ACGT 2 cut(s) 163, 181
Kzo9I GATC 1 cut(s) 62
LpnPI CCDG 1 cut(s) 158
MaeII ACGT 2 cut(s) 163, 181
MalI GATC 1 cut(s) 64
MboI GATC 1 cut(s) 62
MboII GAAGA 1 cut(s) 117
MflI RGATCY 1 cut(s) 62
MluCI AATT 5 cut(s) 11, 71, 125, 168, 232
MnlI CCTC 2 cut(s) 53, 149
MseI TTAA 1 cut(s) 235
NdeII GATC 1 cut(s) 62
Ppu21I YACGTR 1 cut(s) 164
PsuI RGATCY 1 cut(s) 62
SaqAI TTAA 1 cut(s) 235
Sau3AI GATC 1 cut(s) 62
SetI ASST 3 cut(s) 160, 166, 184
SgeI CNNG 2 cut(s) 48, 185
SnaBI TACGTA 1 cut(s) 164
Sse9I AATT 5 cut(s) 11, 71, 125, 168, 232
TaaI ACNGT 1 cut(s) 195
TaiI ACGT 2 cut(s) 166, 184
TasI AATT 5 cut(s) 11, 71, 125, 168, 232
Tru1I TTAA 1 cut(s) 235
Tru9I TTAA 1 cut(s) 235
TspDTI ATGAA 2 cut(s) 4, 8
XapI RAATTY 3 cut(s) 11, 71, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.