MD09G1289300.v1.1

30S ribosomal protein S15

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0020234
Physical Location & Seq
Reverse (-)
37025260 .. 37025535
276 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1289300.v1.1.491

Sequence Viewer

Length: 276 bp
ATGGTAAAAAAATTCATTCATCTCAGTTATTTCACACAAGAAGAAAAAGACGAAAACAAAGGATCTGTTGAATTTCAAATAGTTAGTTTCATCAATAGAATACGAAGACTTACTTCACATTTACAATTACACAAAAAAAACTATTTATCTCAGAGAGGTTTACGTAAAATTATGAGAAAACGCCAACGATTACTGTTTTATTTGTCAAAGAAAAATAGAATTTGTTATAAAGAATTAATTAATCAGTTGGATATTCGGGAGTCAAAAACTCGTTAA

Protein Analysis

92

Amino Acids

11.26

Weight (kDa)

10.57

Isoelectric Point (pI)

41.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 15 - 86 9.7e-21 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020234)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG01120
malus_domestica MD08G1073600.v1.1 MD09G1289300.v1.1 MD12G1214000.v1.1 MD12G1237700.v1.1
rosa_chinensis RchiOBHm_Chr3g0470821

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 228
AclWI GGATC 1 cut(s) 70
AcsI RAATTY 3 cut(s) 11, 71, 219
AgsI TTSAA 2 cut(s) 71, 77
AlwI GGATC 1 cut(s) 70
ApoI RAATTY 3 cut(s) 11, 71, 219
AseI ATTAAT 2 cut(s) 236, 240
BbsI GAAGAC 1 cut(s) 112
BpiI GAAGAC 1 cut(s) 112
BsaAI YACGTR 1 cut(s) 164
BseMII CTCAG 2 cut(s) 37, 164
Bsp143I GATC 1 cut(s) 62
BspCNI CTCAG 2 cut(s) 36, 163
BspPI GGATC 1 cut(s) 70
BssMI GATC 1 cut(s) 62
Bst4CI ACNGT 1 cut(s) 195
BstBAI YACGTR 1 cut(s) 164
BstDEI CTNAG 2 cut(s) 23, 150
BstKTI GATC 1 cut(s) 65
BstMBI GATC 1 cut(s) 62
BstSNI TACGTA 1 cut(s) 164
BstV2I GAAGAC 1 cut(s) 112
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
DdeI CTNAG 2 cut(s) 23, 150
DpnI GATC 1 cut(s) 64
DpnII GATC 1 cut(s) 62
Eco105I TACGTA 1 cut(s) 164
FaiI YATR 2 cut(s) 173, 228
FalI AAGNNNNNCTT 2 cut(s) 97, 129
FspEI CC 6 cut(s) 45, 141, 197, 233, 241, 242
HinfI GANTC 1 cut(s) 260
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 257
Hpy8I GTNNAC 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 195
HpyCH4IV ACGT 1 cut(s) 163
HpyF3I CTNAG 2 cut(s) 23, 150
HpySE526I ACGT 1 cut(s) 163
Kzo9I GATC 1 cut(s) 62
MaeII ACGT 1 cut(s) 163
MalI GATC 1 cut(s) 64
MboI GATC 1 cut(s) 62
MboII GAAGA 2 cut(s) 53, 117
MflI RGATCY 1 cut(s) 62
MluCI AATT 7 cut(s) 11, 71, 125, 168, 219, 233, 237
MlyI GAGTC 1 cut(s) 269
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 1 cut(s) 149
MseI TTAA 3 cut(s) 236, 240, 274
NdeII GATC 1 cut(s) 62
PacI TTAATTAA 1 cut(s) 240
PleI GAGTC 1 cut(s) 268
PpsI GAGTC 1 cut(s) 268
Ppu21I YACGTR 1 cut(s) 164
PshBI ATTAAT 2 cut(s) 236, 240
PsiI TTATAA 1 cut(s) 228
PsuI RGATCY 1 cut(s) 62
SaqAI TTAA 3 cut(s) 236, 240, 274
Sau3AI GATC 1 cut(s) 62
SchI GAGTC 1 cut(s) 269
SetI ASST 2 cut(s) 160, 166
SgeI CNNG 2 cut(s) 50, 269
SnaBI TACGTA 1 cut(s) 164
Sse9I AATT 7 cut(s) 11, 71, 125, 168, 219, 233, 237
TaaI ACNGT 1 cut(s) 195
TaiI ACGT 1 cut(s) 166
TasI AATT 7 cut(s) 11, 71, 125, 168, 219, 233, 237
Tru1I TTAA 3 cut(s) 236, 240, 274
Tru9I TTAA 3 cut(s) 236, 240, 274
TspDTI ATGAA 3 cut(s) 4, 8, 79
VspI ATTAAT 2 cut(s) 236, 240
XapI RAATTY 3 cut(s) 11, 71, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.