Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr12

Orthogroup ID

OG0020234

Physical Location & Seq

Genomic Coordinates Reverse (-)

29229388 .. 29229573

Gene Structure 186 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD12G1214000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGGTAAAAAAATTCATTCATCTCAGTTATTTTCACGAGAAGAAAAAAGACGAAAACAGAGGATCTGTTGAATTTCAAATAGTTAGTTTCACCAATAGGATACGAAGACTTACTTCACATTTACAATTCCACAAAAAAAACTATTTATCTCAGAGAGGTTTACGTAAAATTCTGGGAAAACTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000312 GO:0000313 GO:0000314 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005840 GO:0009507 GO:0009532 GO:0009536 GO:0009547 GO:0009570 GO:0015935 GO:0032991 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0044391 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S15

Protein Analysis

62

Amino Acids

7.43

Weight (kDa)

10.84

Isoelectric Point (pI)

27.42

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_S15	PF00312	14 - 60	1.7e-12	Ribosomal protein S15

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020234)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG01120
malus_domestica	MD08G1073600.v1.1 MD09G1289300.v1.1 MD12G1214000.v1.1 MD12G1237700.v1.1
rosa_chinensis	RchiOBHm_Chr3g0470821

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	70
AcsI	RAATTY	3 cut(s)	11, 71, 168
AgsI	TTSAA	2 cut(s)	71, 77
AlwI	GGATC	1 cut(s)	70
ApoI	RAATTY	3 cut(s)	11, 71, 168
AsuHPI	GGTGA	1 cut(s)	82
BauI	CACGAG	1 cut(s)	35
BbsI	GAAGAC	1 cut(s)	112
BciVI	GTATCC	1 cut(s)	93
BfuI	GTATCC	1 cut(s)	93
BpiI	GAAGAC	1 cut(s)	112
BsaAI	YACGTR	1 cut(s)	164
BseMII	CTCAG	2 cut(s)	37, 164
Bsp143I	GATC	1 cut(s)	62
BspCNI	CTCAG	2 cut(s)	36, 163
BspPI	GGATC	1 cut(s)	70
BssMI	GATC	1 cut(s)	62
BssSI	CACGAG	1 cut(s)	35
Bst2BI	CACGAG	1 cut(s)	35
BstBAI	YACGTR	1 cut(s)	164
BstDEI	CTNAG	2 cut(s)	23, 150
BstKTI	GATC	1 cut(s)	65
BstMBI	GATC	1 cut(s)	62
BstSNI	TACGTA	1 cut(s)	164
BstV2I	GAAGAC	1 cut(s)	112
BstX2I	RGATCY	1 cut(s)	62
BstYI	RGATCY	1 cut(s)	62
BsuI	GTATCC	1 cut(s)	93
DdeI	CTNAG	2 cut(s)	23, 150
DpnI	GATC	1 cut(s)	64
DpnII	GATC	1 cut(s)	62
Eco105I	TACGTA	1 cut(s)	164
FalI	AAGNNNNNCTT	2 cut(s)	97, 129
FspEI	CC	7 cut(s)	45, 82, 106, 141, 143, 158, 159
HphI	GGTGA	1 cut(s)	82
Hpy166II	GTNNAC	1 cut(s)	161
Hpy188I	TCNGA	1 cut(s)	153
Hpy188III	TCNNGA	1 cut(s)	35
Hpy8I	GTNNAC	1 cut(s)	161
HpyCH4IV	ACGT	1 cut(s)	163
HpyF3I	CTNAG	2 cut(s)	23, 150
HpySE526I	ACGT	1 cut(s)	163
Kzo9I	GATC	1 cut(s)	62
LpnPI	CCDG	1 cut(s)	158
MaeII	ACGT	1 cut(s)	163
MalI	GATC	1 cut(s)	64
MboI	GATC	1 cut(s)	62
MboII	GAAGA	2 cut(s)	52, 117
MflI	RGATCY	1 cut(s)	62
MluCI	AATT	4 cut(s)	11, 71, 125, 168
MnlI	CCTC	2 cut(s)	53, 149
NdeII	GATC	1 cut(s)	62
Ppu21I	YACGTR	1 cut(s)	164
PsuI	RGATCY	1 cut(s)	62
Sau3AI	GATC	1 cut(s)	62
SetI	ASST	2 cut(s)	160, 166
SgeI	CNNG	2 cut(s)	47, 49
SnaBI	TACGTA	1 cut(s)	164
Sse9I	AATT	4 cut(s)	11, 71, 125, 168
TaiI	ACGT	1 cut(s)	166
TasI	AATT	4 cut(s)	11, 71, 125, 168
TspDTI	ATGAA	2 cut(s)	4, 8
XapI	RAATTY	3 cut(s)	11, 71, 168

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.