RchiOBHm_Chr3g0470821

30S ribosomal protein S15

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
16768538 .. 16768810
273 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43658

Sequence Viewer

Length: 273 bp
ATGGTAAAAAATTCATTCATCTCAGTTATTTCACAAGAAGAAAAAGAAGAAAACAGGGGTTCTGTTGAATTTCAAATATTTAGTTTCACCCATAGGATACGAAGACTTATTTCACATTTACAATTACACAAAAAAGACTATTTATCTCAGAGAGGTCTACGTAAAATTCTGGGAAAACGCCAACGACTGCTATCTTATTTGTCAAAGAAAAATAGAATAGGTTATAAAGAATTAATTAATCGGTTCGATATTCGGGAATCAAAAACTCGTTAA

Protein Analysis

90

Amino Acids

10.92

Weight (kDa)

10.81

Isoelectric Point (pI)

44.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 13 - 85 3.4e-23 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020234)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG01120
malus_domestica MD08G1073600.v1.1 MD09G1289300.v1.1 MD12G1214000.v1.1 MD12G1237700.v1.1
rosa_chinensis RchiOBHm_Chr3g0470821

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 225
AccI GTMKAC 1 cut(s) 157
AcsI RAATTY 3 cut(s) 10, 68, 165
AgsI TTSAA 2 cut(s) 68, 74
ApoI RAATTY 3 cut(s) 10, 68, 165
AseI ATTAAT 2 cut(s) 233, 237
AsuHPI GGTGA 1 cut(s) 79
BbsI GAAGAC 1 cut(s) 109
BciVI GTATCC 1 cut(s) 90
BfuI GTATCC 1 cut(s) 90
BpiI GAAGAC 1 cut(s) 109
BsaAI YACGTR 1 cut(s) 161
BseMII CTCAG 2 cut(s) 36, 161
BspCNI CTCAG 2 cut(s) 35, 160
BstBAI YACGTR 1 cut(s) 161
BstDEI CTNAG 2 cut(s) 22, 147
BstSNI TACGTA 1 cut(s) 161
BstV2I GAAGAC 1 cut(s) 109
BsuI GTATCC 1 cut(s) 90
DdeI CTNAG 2 cut(s) 22, 147
Eco105I TACGTA 1 cut(s) 161
FaiI YATR 2 cut(s) 93, 225
FblI GTMKAC 1 cut(s) 157
HinfI GANTC 1 cut(s) 257
HphI GGTGA 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 158
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 254
Hpy8I GTNNAC 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 160
HpyF3I CTNAG 2 cut(s) 22, 147
HpySE526I ACGT 1 cut(s) 160
LpnPI CCDG 2 cut(s) 40, 155
MaeII ACGT 1 cut(s) 160
MboII GAAGA 3 cut(s) 50, 59, 114
MluCI AATT 6 cut(s) 10, 68, 122, 165, 230, 234
MnlI CCTC 1 cut(s) 146
MseI TTAA 3 cut(s) 233, 237, 271
PacI TTAATTAA 1 cut(s) 237
PfeI GAWTC 1 cut(s) 257
Ppu21I YACGTR 1 cut(s) 161
PshBI ATTAAT 2 cut(s) 233, 237
PsiI TTATAA 1 cut(s) 225
SaqAI TTAA 3 cut(s) 233, 237, 271
SetI ASST 3 cut(s) 157, 163, 223
SgeI CNNG 4 cut(s) 47, 67, 182, 266
SnaBI TACGTA 1 cut(s) 161
Sse9I AATT 6 cut(s) 10, 68, 122, 165, 230, 234
SspI AATATT 1 cut(s) 78
TaiI ACGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 246
TasI AATT 6 cut(s) 10, 68, 122, 165, 230, 234
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 3 cut(s) 233, 237, 271
Tru9I TTAA 3 cut(s) 233, 237, 271
TspDTI ATGAA 1 cut(s) 7
VspI ATTAAT 2 cut(s) 233, 237
XapI RAATTY 3 cut(s) 10, 68, 165
XmiI GTMKAC 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.