Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020234

Physical Location & Seq

Genomic Coordinates Reverse (-)

16768538 .. 16768810

Gene Structure 273 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ43658

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

ATGGTAAAAAATTCATTCATCTCAGTTATTTCACAAGAAGAAAAAGAAGAAAACAGGGGTTCTGTTGAATTTCAAATATTTAGTTTCACCCATAGGATACGAAGACTTATTTCACATTTACAATTACACAAAAAAGACTATTTATCTCAGAGAGGTCTACGTAAAATTCTGGGAAAACGCCAACGACTGCTATCTTATTTGTCAAAGAAAAATAGAATAGGTTATAAAGAATTAATTAATCGGTTCGATATTCGGGAATCAAAAACTCGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000312 GO:0000313 GO:0000314 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005840 GO:0009507 GO:0009532 GO:0009536 GO:0009547 GO:0009570 GO:0015935 GO:0032991 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0044391 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S15

Protein Analysis

90

Amino Acids

10.92

Weight (kDa)

10.81

Isoelectric Point (pI)

44.69

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_S15	PF00312	13 - 85	3.4e-23	Ribosomal protein S15

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020234)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG01120
malus_domestica	MD08G1073600.v1.1 MD09G1289300.v1.1 MD12G1214000.v1.1 MD12G1237700.v1.1
rosa_chinensis	RchiOBHm_Chr3g0470821

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	225
AccI	GTMKAC	1 cut(s)	157
AcsI	RAATTY	3 cut(s)	10, 68, 165
AgsI	TTSAA	2 cut(s)	68, 74
ApoI	RAATTY	3 cut(s)	10, 68, 165
AseI	ATTAAT	2 cut(s)	233, 237
AsuHPI	GGTGA	1 cut(s)	79
BbsI	GAAGAC	1 cut(s)	109
BciVI	GTATCC	1 cut(s)	90
BfuI	GTATCC	1 cut(s)	90
BpiI	GAAGAC	1 cut(s)	109
BsaAI	YACGTR	1 cut(s)	161
BseMII	CTCAG	2 cut(s)	36, 161
BspCNI	CTCAG	2 cut(s)	35, 160
BstBAI	YACGTR	1 cut(s)	161
BstDEI	CTNAG	2 cut(s)	22, 147
BstSNI	TACGTA	1 cut(s)	161
BstV2I	GAAGAC	1 cut(s)	109
BsuI	GTATCC	1 cut(s)	90
DdeI	CTNAG	2 cut(s)	22, 147
Eco105I	TACGTA	1 cut(s)	161
FaiI	YATR	2 cut(s)	93, 225
FblI	GTMKAC	1 cut(s)	157
HinfI	GANTC	1 cut(s)	257
HphI	GGTGA	1 cut(s)	79
Hpy166II	GTNNAC	1 cut(s)	158
Hpy188I	TCNGA	1 cut(s)	150
Hpy188III	TCNNGA	1 cut(s)	254
Hpy8I	GTNNAC	1 cut(s)	158
HpyCH4IV	ACGT	1 cut(s)	160
HpyF3I	CTNAG	2 cut(s)	22, 147
HpySE526I	ACGT	1 cut(s)	160
LpnPI	CCDG	2 cut(s)	40, 155
MaeII	ACGT	1 cut(s)	160
MboII	GAAGA	3 cut(s)	50, 59, 114
MluCI	AATT	6 cut(s)	10, 68, 122, 165, 230, 234
MnlI	CCTC	1 cut(s)	146
MseI	TTAA	3 cut(s)	233, 237, 271
PacI	TTAATTAA	1 cut(s)	237
PfeI	GAWTC	1 cut(s)	257
Ppu21I	YACGTR	1 cut(s)	161
PshBI	ATTAAT	2 cut(s)	233, 237
PsiI	TTATAA	1 cut(s)	225
SaqAI	TTAA	3 cut(s)	233, 237, 271
SetI	ASST	3 cut(s)	157, 163, 223
SgeI	CNNG	4 cut(s)	47, 67, 182, 266
SnaBI	TACGTA	1 cut(s)	161
Sse9I	AATT	6 cut(s)	10, 68, 122, 165, 230, 234
SspI	AATATT	1 cut(s)	78
TaiI	ACGT	1 cut(s)	163
TaqI	TCGA	1 cut(s)	246
TasI	AATT	6 cut(s)	10, 68, 122, 165, 230, 234
TfiI	GAWTC	1 cut(s)	257
Tru1I	TTAA	3 cut(s)	233, 237, 271
Tru9I	TTAA	3 cut(s)	233, 237, 271
TspDTI	ATGAA	1 cut(s)	7
VspI	ATTAAT	2 cut(s)	233, 237
XapI	RAATTY	3 cut(s)	10, 68, 165
XmiI	GTMKAC	1 cut(s)	157

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.