MD09G1142600.v1.1

transferase activity, transferring hexosyl groups

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
11136956 .. 11137297
342 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1142600.v1.1.491

Sequence Viewer

Length: 342 bp
ATGAAATATACAACAAACATTAAAACCAAAACTCAACAAGATTGGATTCCAGGAATGAAAGATATCCGTTTAAAGGAGCTCCCAACCTTTATTCGGACTTCAGATCCTGATGATATCATGTTTAACTTCATGATGGAGGTAACTGATAGAGTTCATGAAGCTTTTGCAATTGTTCTTCATACTTTTGATGCCTTAGAGCCAGATGTATTGGAAGCTCTCTCATCTATGCTTCCACTTGTTTATCCAATTGGCCATCTTGAATTACATCTGAATCAAATACCAGATCACCCATTGAATATTGGATACAATCTGTGGAAAGAAGAAACAAAATGCCTCGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

13.2

Weight (kDa)

4.93

Isoelectric Point (pI)

25.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019277)

Species Orthologous Gene IDs
malus_domestica MD09G1142600.v1.1
pyrus_communis pycom17g11750
rosa_chinensis RchiOBHm_Chr2g0153931
rosa_laevigata RLG00000020739 RLG00000020767
rosa_multiflora Rmu_co8139412.1_g000001 Rmu_sc0025169.1_g000002
rosa_samantha Rh2BG517100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 98
AcoI YGGCCR 1 cut(s) 250
AcuI CTGAAG 1 cut(s) 84
AfiI CCNNNNNNNGG 2 cut(s) 73, 93
AgsI TTSAA 2 cut(s) 260, 295
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 3 cut(s) 79, 161, 215
AluI AGCT 3 cut(s) 79, 161, 215
Alw21I GWGCWC 1 cut(s) 81
AlwI GGATC 1 cut(s) 98
AlwNI CAGNNNCTG 1 cut(s) 107
AoxI GGCC 1 cut(s) 250
AsuHPI GGTGA 1 cut(s) 278
BalI TGGCCA 1 cut(s) 252
BanII GRGCYC 1 cut(s) 81
Bbv12I GWGCWC 1 cut(s) 81
BccI CCATC 2 cut(s) 127, 261
BciT130I CCWGG 1 cut(s) 51
BciVI GTATCC 1 cut(s) 296
BfaI CTAG 1 cut(s) 340
BfuI GTATCC 1 cut(s) 296
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 178
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 93
BseBI CCWGG 1 cut(s) 51
BseLI CCNNNNNNNGG 2 cut(s) 73, 93
BshFI GGCC 1 cut(s) 252
BsiHKAI GWGCWC 1 cut(s) 81
BslI CCNNNNNNNGG 2 cut(s) 73, 93
BsnI GGCC 1 cut(s) 252
Bsp1286I GDGCHC 1 cut(s) 81
Bsp143I GATC 2 cut(s) 103, 283
BspANI GGCC 1 cut(s) 252
BspHI TCATGA 2 cut(s) 129, 154
BspPI GGATC 1 cut(s) 98
BssMI GATC 2 cut(s) 103, 283
Bst2UI CCWGG 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 193
BstKTI GATC 2 cut(s) 106, 286
BstMBI GATC 2 cut(s) 103, 283
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BstX2I RGATCY 1 cut(s) 103
BstYI RGATCY 1 cut(s) 103
BsuI GTATCC 1 cut(s) 296
BsuRI GGCC 1 cut(s) 252
CaiI CAGNNNCTG 1 cut(s) 107
CciI TCATGA 2 cut(s) 129, 154
CviAII CATG 3 cut(s) 118, 130, 155
CviJI RGCY 5 cut(s) 79, 161, 199, 215, 252
CviKI_1 RGCY 5 cut(s) 79, 161, 199, 215, 252
DdeI CTNAG 1 cut(s) 193
DpnI GATC 2 cut(s) 105, 285
DpnII GATC 2 cut(s) 103, 283
DraI TTTAAA 1 cut(s) 72
EaeI YGGCCR 1 cut(s) 250
Ecl136II GAGCTC 1 cut(s) 79
Eco24I GRGCYC 1 cut(s) 81
Eco32I GATATC 2 cut(s) 64, 115
Eco53kI GAGCTC 1 cut(s) 79
Eco57I CTGAAG 1 cut(s) 84
EcoICRI GAGCTC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 49
EcoRV GATATC 2 cut(s) 64, 115
EcoT38I GRGCYC 1 cut(s) 81
FaeI CATG 3 cut(s) 121, 133, 158
FaiI YATR 6 cut(s) 9, 119, 131, 156, 180, 227
FatI CATG 3 cut(s) 117, 129, 154
FriOI GRGCYC 1 cut(s) 81
FspBI CTAG 1 cut(s) 340
HaeIII GGCC 1 cut(s) 252
Hin1II CATG 3 cut(s) 121, 133, 158
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 2 cut(s) 46, 271
HphI GGTGA 1 cut(s) 278
Hpy188I TCNGA 3 cut(s) 96, 103, 270
Hpy188III TCNNGA 4 cut(s) 107, 130, 155, 257
HpyCH4V TGCA 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 193
Hsp92II CATG 3 cut(s) 121, 133, 158
Kzo9I GATC 2 cut(s) 103, 283
LmnI GCTCC 2 cut(s) 76, 84
LpnPI CCDG 5 cut(s) 36, 63, 120, 213, 294
LweI GCATC 1 cut(s) 178
MaeI CTAG 1 cut(s) 340
MaeIII GTNAC 1 cut(s) 139
MalI GATC 2 cut(s) 105, 285
MboI GATC 2 cut(s) 103, 283
MboII GAAGA 2 cut(s) 167, 332
MfeI CAATTG 2 cut(s) 168, 246
MflI RGATCY 1 cut(s) 103
MhlI GDGCHC 1 cut(s) 81
MlsI TGGCCA 1 cut(s) 252
MluCI AATT 3 cut(s) 168, 246, 260
MluNI TGGCCA 1 cut(s) 252
MnlI CCTC 1 cut(s) 130
Mox20I TGGCCA 1 cut(s) 252
MscI TGGCCA 1 cut(s) 252
MseI TTAA 3 cut(s) 21, 71, 123
Msp20I TGGCCA 1 cut(s) 252
MspR9I CCNGG 1 cut(s) 51
MunI CAATTG 2 cut(s) 168, 246
MvaI CCWGG 1 cut(s) 51
NdeII GATC 2 cut(s) 103, 283
NlaIII CATG 3 cut(s) 121, 133, 158
PagI TCATGA 2 cut(s) 129, 154
PfeI GAWTC 2 cut(s) 46, 271
PfoI TCCNGGA 1 cut(s) 49
Psp124BI GAGCTC 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PstNI CAGNNNCTG 1 cut(s) 107
PsuI RGATCY 1 cut(s) 103
SacI GAGCTC 1 cut(s) 81
SaqAI TTAA 3 cut(s) 21, 71, 123
Sau3AI GATC 2 cut(s) 103, 283
ScrFI CCNGG 1 cut(s) 51
SduI GDGCHC 1 cut(s) 81
SetI ASST 5 cut(s) 81, 89, 141, 163, 217
SfaNI GCATC 1 cut(s) 178
Sse9I AATT 3 cut(s) 168, 246, 260
SspI AATATT 1 cut(s) 298
SspMI CTAG 1 cut(s) 340
SstI GAGCTC 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 49
TaqI TCGA 1 cut(s) 336
TasI AATT 3 cut(s) 168, 246, 260
TfiI GAWTC 2 cut(s) 46, 271
Tru1I TTAA 3 cut(s) 21, 71, 123
Tru9I TTAA 3 cut(s) 21, 71, 123
TspDTI ATGAA 6 cut(s) 17, 71, 118, 143, 167, 171
TspGWI ACGGA 1 cut(s) 56
XspI CTAG 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.