Rh2BG517100

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
72561300 .. 72561674
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG517100.1

Sequence Viewer

Length: 375 bp
ATGGGGTTTCTGGACAAGCTAATAGATTGGATTCTAGGAATGAAAGGTATCCGCTTAAAAGATCTACCAACCGAGTTTCGAACTACGAATCCCAGTGACCTCATTTTCAATGGCATTCTTGATGTAATGGGTAGCCTTCATAGAGCTTCAGCAGTTGTTCTTCACACATTTGACGCATTGGAGACAGATATTTTGGATGCTCTCTCTAGCACTACATCTATGCTCCCACCAGTTTATGCCATTGGCCCACTGCAATTACTTCTCAATCAAAAACAAGAAGACCCTTTGAAGCCTATAGGATACAGCCTATGGAAAGAAGAAACTGAGTGCCTACAATTGCTAACAATAAGGCACCAAACTAAGTTGTTTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.01

Weight (kDa)

5.22

Isoelectric Point (pI)

41.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019277)

Species Orthologous Gene IDs
malus_domestica MD09G1142600.v1.1
pyrus_communis pycom17g11750
rosa_chinensis RchiOBHm_Chr2g0153931
rosa_laevigata RLG00000020739 RLG00000020767
rosa_multiflora Rmu_co8139412.1_g000001 Rmu_sc0025169.1_g000002
rosa_samantha Rh2BG517100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 351
AciI CCGC 1 cut(s) 52
AcuI CTGAAG 1 cut(s) 132
AgsI TTSAA 2 cut(s) 109, 289
AloI GAACNNNNNNTCC 2 cut(s) 73, 105
AluBI AGCT 2 cut(s) 19, 146
AluI AGCT 2 cut(s) 19, 146
Alw26I GTCTC 1 cut(s) 176
AoxI GGCC 1 cut(s) 244
ArsI GACNNNNNNTTYG 2 cut(s) 175, 207
AspS9I GGNCC 1 cut(s) 245
AsuII TTCGAA 1 cut(s) 79
BanI GGYRCC 1 cut(s) 351
BbsI GAAGAC 1 cut(s) 285
BciVI GTATCC 2 cut(s) 59, 293
BcoDI GTCTC 1 cut(s) 176
BfaI CTAG 2 cut(s) 35, 207
BfmI CTRYAG 1 cut(s) 294
BfuI GTATCC 2 cut(s) 59, 293
BglII AGATCT 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 245
BmiI GGNNCC 1 cut(s) 353
BmrI ACTGGG 1 cut(s) 87
BmsI GCATC 1 cut(s) 187
BmuI ACTGGG 1 cut(s) 87
BpiI GAAGAC 1 cut(s) 285
Bpu14I TTCGAA 1 cut(s) 79
Bse1I ACTGG 2 cut(s) 93, 230
BseGI GGATG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 315
BseNI ACTGG 2 cut(s) 93, 230
BshFI GGCC 1 cut(s) 246
BshNI GGYRCC 1 cut(s) 351
BsmAI GTCTC 1 cut(s) 176
BsmI GAATGC 1 cut(s) 114
BsnI GGCC 1 cut(s) 246
Bsp119I TTCGAA 1 cut(s) 79
Bsp143I GATC 1 cut(s) 61
BspACI CCGC 1 cut(s) 52
BspANI GGCC 1 cut(s) 246
BspCNI CTCAG 1 cut(s) 316
BspLI GGNNCC 1 cut(s) 353
BspT104I TTCGAA 1 cut(s) 79
BspT107I GGYRCC 1 cut(s) 351
BsrI ACTGG 2 cut(s) 93, 230
BssMI GATC 1 cut(s) 61
BstBI TTCGAA 1 cut(s) 79
BstDEI CTNAG 2 cut(s) 324, 360
BstF5I GGATG 1 cut(s) 202
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 176
BstMBI GATC 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 294
BstV2I GAAGAC 1 cut(s) 285
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BsuI GTATCC 2 cut(s) 59, 293
BsuRI GGCC 1 cut(s) 246
BtsCI GGATG 1 cut(s) 202
BtsI GCAGTG 1 cut(s) 248
BtsIMutI CAGTG 2 cut(s) 100, 248
Cfr13I GGNCC 1 cut(s) 245
CseI GACGC 1 cut(s) 182
CviJI RGCY 6 cut(s) 19, 135, 146, 246, 292, 306
CviKI_1 RGCY 6 cut(s) 19, 135, 146, 246, 292, 306
DdeI CTNAG 2 cut(s) 324, 360
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 132
FaiI YATR 6 cut(s) 141, 221, 237, 296, 310, 371
FokI GGATG 1 cut(s) 209
FspBI CTAG 2 cut(s) 35, 207
HaeIII GGCC 1 cut(s) 246
HgaI GACGC 1 cut(s) 182
HinfI GANTC 2 cut(s) 31, 88
Hpy188III TCNNGA 2 cut(s) 11, 119
HpyAV CCTTC 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 253
HpyF3I CTNAG 2 cut(s) 324, 360
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 228
LpnPI CCDG 2 cut(s) 106, 243
LweI GCATC 1 cut(s) 187
MaeI CTAG 2 cut(s) 35, 207
MaeIII GTNAC 1 cut(s) 95
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 3 cut(s) 152, 290, 329
MfeI CAATTG 1 cut(s) 335
MflI RGATCY 1 cut(s) 61
MluCI AATT 2 cut(s) 254, 335
MnlI CCTC 1 cut(s) 110
MseI TTAA 1 cut(s) 56
MunI CAATTG 1 cut(s) 335
Mva1269I GAATGC 1 cut(s) 114
NdeII GATC 1 cut(s) 61
NlaIV GGNNCC 1 cut(s) 353
NmuCI GTSAC 1 cut(s) 95
NspV TTCGAA 1 cut(s) 79
PctI GAATGC 1 cut(s) 114
PfeI GAWTC 2 cut(s) 31, 88
PspN4I GGNNCC 1 cut(s) 353
PspPI GGNCC 1 cut(s) 245
PsuI RGATCY 1 cut(s) 61
SaqAI TTAA 1 cut(s) 56
Sau3AI GATC 1 cut(s) 61
Sau96I GGNCC 1 cut(s) 245
SetI ASST 4 cut(s) 21, 49, 102, 148
SfaNI GCATC 1 cut(s) 187
SfcI CTRYAG 1 cut(s) 294
SfuI TTCGAA 1 cut(s) 79
SgeI CNNG 9 cut(s) 23, 28, 47, 85, 105, 131, 219, 242, 287
Sse9I AATT 2 cut(s) 254, 335
SsiI CCGC 1 cut(s) 52
SspMI CTAG 2 cut(s) 35, 207
TaqI TCGA 1 cut(s) 79
TasI AATT 2 cut(s) 254, 335
TfiI GAWTC 2 cut(s) 31, 88
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TscAI CASTG 2 cut(s) 100, 255
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 2 cut(s) 56, 128
TspRI CASTG 2 cut(s) 100, 255
XspI CTAG 2 cut(s) 35, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.