MD10G1311300.v1.1

Protein of unknown function (DUF1218)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
39629228 .. 39630494
1267 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1311300.v1.1.491

Sequence Viewer

Length: 522 bp
ATGGTTAAAAACGCTACTCCTCTCATCTGCCTCTCGGTCTTGATTATGGACGTCGTGGCCGGAATCCTTGGGATTCAAGCCGAGATTGCTCAAAACAAGGTGCACCATTTGAAGGTGTGGATCTTTGAGTGCAAGGACCCAAGTTACCAAGCCTTCAAATTAGGGTTGGCAGCTGCTGTGATACTAGCAGTTGCACATGTTATAGGCAACTTGCTTGGTGGCTGCATTTGCATCTCGTCCAAGGAAGATTACCAAAAAGCCACAGCAAATAAGCAATTAGCAATTGCTTCCCTCATCTTATCATGGATCACATTGGCGGTGGCATTTTCGCTGCTGATTGCGGGGGCAATGTCAAACAGAAAGTCGAGAAAATCGTGCGGGTTATCACACCATCGGGTTCTGTCCATCGGAGGGATCTTATGCTTCTTCCATGGATTGTTCATCATTGCATATTACGCCTCTGCCAAAGCCACGTTCAAAGAAGGGAAACCCAAACCCACCACACCCAGCAACCCAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

18.48

Weight (kDa)

9.51

Isoelectric Point (pI)

29.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1218 PF06749 58 - 145 1.2e-23 Protein of unknown function (DUF1218)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014095)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21310 AT4G21310
fragaria_vesca FvH4_3g02950
malus_domestica MD10G1311300.v1.1
prunus_persica Prupe.4G029600_v2.0.a1
pyrus_communis pycom10g26250
rosa_chinensis RchiOBHm_Chr5g0004561
rosa_laevigata RLG00000031240
rosa_multiflora Rmu_sc0002354.1_g000018 Rmu_sc0003758.1_g000012
rosa_roxburghii Rroxscaffold_1G00070970
rosa_rugosa Rorug04G0412200
rosa_samantha Rh5AG040200 Rh5BG039600 Rh5CG043500 Rh5DG039300
rosa_wichuraiana Rw5G003860

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 54
AciI CCGC 3 cut(s) 317, 341, 378
AclWI GGATC 3 cut(s) 128, 314, 422
AcoI YGGCCR 1 cut(s) 57
AcyI GRCGYC 1 cut(s) 51
AfiI CCNNNNNNNGG 2 cut(s) 112, 411
AflIII ACRYGT 1 cut(s) 196
AgsI TTSAA 4 cut(s) 77, 112, 157, 478
AjuI GAANNNNNNNTTGG 2 cut(s) 458, 490
AluBI AGCT 2 cut(s) 173, 518
AluI AGCT 2 cut(s) 173, 518
Alw21I GWGCWC 1 cut(s) 105
Alw44I GTGCAC 1 cut(s) 101
AlwI GGATC 3 cut(s) 128, 314, 422
AlwNI CAGNNNCTG 1 cut(s) 176
AoxI GGCC 1 cut(s) 57
ApaLI GTGCAC 1 cut(s) 101
ApeKI GCWGC 4 cut(s) 170, 173, 222, 331
ArsI GACNNNNNNTTYG 2 cut(s) 347, 379
AspS9I GGNCC 1 cut(s) 136
AvaII GGWCC 1 cut(s) 136
BaeGI GKGCMC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 105
BbvI GCAGC 4 cut(s) 160, 182, 209, 318
BccI CCATC 2 cut(s) 399, 413
BfaI CTAG 1 cut(s) 185
BisI GCNGC 4 cut(s) 171, 174, 223, 332
BlsI GCNGC 4 cut(s) 172, 175, 224, 333
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 138
BmsI GCATC 1 cut(s) 240
BsaHI GRCGYC 1 cut(s) 51
BsaJI CCNNGG 3 cut(s) 67, 240, 430
Bsc4I CCNNNNNNNGG 2 cut(s) 112, 411
Bse3DI GCAATG 2 cut(s) 354, 444
BseDI CCNNGG 3 cut(s) 67, 240, 430
BseLI CCNNNNNNNGG 2 cut(s) 112, 411
BseMI GCAATG 2 cut(s) 354, 444
BseRI GAGGAG 1 cut(s) 9
BseSI GKGCMC 1 cut(s) 105
BseXI GCAGC 4 cut(s) 160, 182, 209, 318
BseYI CCCAGC 2 cut(s) 506, 514
BshFI GGCC 1 cut(s) 59
BsiHKAI GWGCWC 1 cut(s) 105
BsiSI CCGG 1 cut(s) 60
BslI CCNNNNNNNGG 2 cut(s) 112, 411
BsnI GGCC 1 cut(s) 59
Bsp1286I GDGCHC 1 cut(s) 105
Bsp143I GATC 3 cut(s) 120, 306, 414
Bsp19I CCATGG 1 cut(s) 430
BspACI CCGC 3 cut(s) 317, 341, 378
BspANI GGCC 1 cut(s) 59
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 3 cut(s) 128, 314, 422
BsrDI GCAATG 2 cut(s) 354, 444
BssECI CCNNGG 3 cut(s) 67, 240, 430
BssMI GATC 3 cut(s) 120, 306, 414
BssNI GRCGYC 1 cut(s) 51
BssT1I CCWWGG 3 cut(s) 67, 240, 430
BstACI GRCGYC 1 cut(s) 51
BstDSI CCRYGG 1 cut(s) 430
BstKTI GATC 3 cut(s) 123, 309, 417
BstMBI GATC 3 cut(s) 120, 306, 414
BstMWI GCNNNNNNNGC 3 cut(s) 86, 228, 455
BstNSI RCATGY 1 cut(s) 200
BstSLI GKGCMC 1 cut(s) 105
BstV1I GCAGC 4 cut(s) 160, 182, 209, 318
BstX2I RGATCY 2 cut(s) 120, 414
BstYI RGATCY 2 cut(s) 120, 414
BsuRI GGCC 1 cut(s) 59
BtgI CCRYGG 1 cut(s) 430
CaiI CAGNNNCTG 1 cut(s) 176
Cfr13I GGNCC 1 cut(s) 136
CviAII CATG 3 cut(s) 197, 303, 431
CviJI RGCY 8 cut(s) 59, 80, 152, 173, 222, 260, 470, 518
CviKI_1 RGCY 8 cut(s) 59, 80, 152, 173, 222, 260, 470, 518
DpnI GATC 3 cut(s) 122, 308, 416
DpnII GATC 3 cut(s) 120, 306, 414
EaeI YGGCCR 1 cut(s) 57
Eco130I CCWWGG 3 cut(s) 67, 240, 430
Eco47I GGWCC 1 cut(s) 136
EcoO109I RGGNCCY 1 cut(s) 136
EcoT14I CCWWGG 3 cut(s) 67, 240, 430
ErhI CCWWGG 3 cut(s) 67, 240, 430
FaeI CATG 3 cut(s) 200, 306, 434
FaiI YATR 7 cut(s) 47, 198, 203, 304, 421, 432, 451
FatI CATG 3 cut(s) 196, 302, 430
FauI CCCGC 2 cut(s) 334, 371
Fnu4HI GCNGC 4 cut(s) 171, 174, 223, 332
Fsp4HI GCNGC 4 cut(s) 171, 174, 223, 332
FspBI CTAG 1 cut(s) 185
GluI GCNGC 4 cut(s) 171, 174, 223, 332
GsaI CCCAGC 2 cut(s) 510, 518
HaeIII GGCC 1 cut(s) 59
HapII CCGG 1 cut(s) 60
Hin1I GRCGYC 1 cut(s) 51
Hin1II CATG 3 cut(s) 200, 306, 434
HinfI GANTC 2 cut(s) 63, 73
HpaII CCGG 1 cut(s) 60
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 410
Hpy188III TCNNGA 2 cut(s) 40, 366
Hpy8I GTNNAC 1 cut(s) 103
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 3 cut(s) 106, 163, 476
HpyCH4IV ACGT 2 cut(s) 51, 473
HpyCH4V TGCA 6 cut(s) 103, 132, 194, 225, 231, 449
HpyF10VI GCNNNNNNNGC 3 cut(s) 86, 228, 455
HpySE526I ACGT 2 cut(s) 51, 473
Hsp92I GRCGYC 1 cut(s) 51
Hsp92II CATG 3 cut(s) 200, 306, 434
Kzo9I GATC 3 cut(s) 120, 306, 414
LpnPI CCDG 1 cut(s) 73
Lsp1109I GCAGC 4 cut(s) 160, 182, 209, 318
LweI GCATC 1 cut(s) 240
MaeI CTAG 1 cut(s) 185
MaeII ACGT 2 cut(s) 51, 473
MaeIII GTNAC 1 cut(s) 143
MalI GATC 3 cut(s) 122, 308, 416
MboI GATC 3 cut(s) 120, 306, 414
MboII GAAGA 2 cut(s) 257, 418
MfeI CAATTG 1 cut(s) 282
MflI RGATCY 2 cut(s) 120, 414
MhlI GDGCHC 1 cut(s) 105
MluCI AATT 3 cut(s) 158, 275, 282
MnlI CCTC 5 cut(s) 30, 41, 302, 404, 469
MseI TTAA 1 cut(s) 6
MspA1I CMGCKG 1 cut(s) 173
MspI CCGG 1 cut(s) 60
MunI CAATTG 1 cut(s) 282
MwoI GCNNNNNNNGC 3 cut(s) 86, 228, 455
NcoI CCATGG 1 cut(s) 430
NdeII GATC 3 cut(s) 120, 306, 414
NlaIII CATG 3 cut(s) 200, 306, 434
NlaIV GGNNCC 1 cut(s) 138
NmeAIII GCCGAG 1 cut(s) 106
NspI RCATGY 1 cut(s) 200
PciI ACATGT 1 cut(s) 196
PcsI WCGNNNNNNNCGW 1 cut(s) 371
PfeI GAWTC 2 cut(s) 63, 73
PkrI GCNGC 4 cut(s) 172, 175, 224, 333
PpuMI RGGWCCY 1 cut(s) 136
PscI ACATGT 1 cut(s) 196
Psp5II RGGWCCY 1 cut(s) 136
PspFI CCCAGC 2 cut(s) 506, 514
PspN4I GGNNCC 1 cut(s) 138
PspPI GGNCC 1 cut(s) 136
PspPPI RGGWCCY 1 cut(s) 136
PstNI CAGNNNCTG 1 cut(s) 176
PsuI RGATCY 2 cut(s) 120, 414
PvuII CAGCTG 1 cut(s) 173
SaqAI TTAA 1 cut(s) 6
SatI GCNGC 4 cut(s) 171, 174, 223, 332
Sau3AI GATC 3 cut(s) 120, 306, 414
Sau96I GGNCC 1 cut(s) 136
SduI GDGCHC 1 cut(s) 105
SetI ASST 6 cut(s) 54, 102, 117, 175, 476, 520
SfaNI GCATC 1 cut(s) 240
SinI GGWCC 1 cut(s) 136
Sse9I AATT 3 cut(s) 158, 275, 282
SsiI CCGC 3 cut(s) 317, 341, 378
SspMI CTAG 1 cut(s) 185
StyI CCWWGG 3 cut(s) 67, 240, 430
TaiI ACGT 2 cut(s) 54, 476
TaqI TCGA 1 cut(s) 365
TaqII GACCGA 1 cut(s) 25
TasI AATT 3 cut(s) 158, 275, 282
TfiI GAWTC 2 cut(s) 63, 73
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TseI GCWGC 4 cut(s) 170, 173, 222, 331
TspDTI ATGAA 1 cut(s) 430
VneI GTGCAC 1 cut(s) 101
VpaK11BI GGWCC 1 cut(s) 136
XceI RCATGY 1 cut(s) 200
XspI CTAG 1 cut(s) 185
ZraI GACGTC 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.