MD11G1020400.v1.1

transfer

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
1758577 .. 1762931
4355 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1020400.v1.1.491

Sequence Viewer

Length: 126 bp
ATGGAAATTGGCAAGTTCACCCAAACCTGTCGTCTCGTTTCTCCTCTCATTCGACACTTAGGCGTCGCTTTGAAGTTCGCCGACATAGAGTACTCTGCTGAGGTTAATGGGATTCAAAGGCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

42

Amino Acids

4.63

Weight (kDa)

7.96

Isoelectric Point (pI)

31.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019787)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 63
AfaI GTAC 1 cut(s) 92
AgsI TTSAA 2 cut(s) 73, 116
Alw26I GTCTC 1 cut(s) 38
ArsI GACNNNNNNTTYG 2 cut(s) 16, 48
AsuHPI GGTGA 1 cut(s) 10
BbvCI CCTCAGC 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 38
BmcAI AGTACT 1 cut(s) 92
Bpu10I CCTNAGC 1 cut(s) 99
BsaHI GRCGYC 1 cut(s) 63
BseMII CTCAG 1 cut(s) 90
BseRI GAGGAG 1 cut(s) 33
BsmAI GTCTC 1 cut(s) 38
BsmBI CGTCTC 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 91
BssNI GRCGYC 1 cut(s) 63
BstACI GRCGYC 1 cut(s) 63
BstDEI CTNAG 2 cut(s) 58, 99
BstMAI GTCTC 1 cut(s) 38
CseI GACGC 1 cut(s) 52
Csp6I GTAC 1 cut(s) 91
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 2 cut(s) 58, 99
Esp3I CGTCTC 1 cut(s) 38
FaiI YATR 1 cut(s) 86
HgaI GACGC 1 cut(s) 52
Hin1I GRCGYC 1 cut(s) 63
HinfI GANTC 1 cut(s) 112
HphI GGTGA 1 cut(s) 10
Hpy166II GTNNAC 1 cut(s) 18
Hpy8I GTNNAC 1 cut(s) 18
Hpy99I CGWCG 1 cut(s) 68
HpyF3I CTNAG 2 cut(s) 58, 99
Hsp92I GRCGYC 1 cut(s) 63
LpnPI CCDG 1 cut(s) 40
MluCI AATT 1 cut(s) 6
MnlI CCTC 2 cut(s) 54, 94
MseI TTAA 1 cut(s) 105
PfeI GAWTC 1 cut(s) 112
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 105
ScaI AGTACT 1 cut(s) 92
SetI ASST 2 cut(s) 29, 105
SgeI CNNG 3 cut(s) 25, 39, 47
Sse9I AATT 1 cut(s) 6
TaqI TCGA 1 cut(s) 52
TasI AATT 1 cut(s) 6
TatI WGTACW 1 cut(s) 90
TfiI GAWTC 1 cut(s) 112
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
ZrmI AGTACT 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.